Disclaimer: This is Untrue.


2.1.12 Origin of the First Higher Living Thing and Various Species

2.1.12.1 Rael's Claims

According to Rael, Yahweh says the theory of evolution is not so correct. Evolution of the various forms could be said to be in a sense just sophistication of the creators' work. A large variety of living things, such as the colors of birds, their mating rituals, and the shape of antelope horns, could not be produced by chance. They are work of artists.

2.1.12.2 Consideration for Evolution

2.1.12.2.1 General Consideration for Decorative Functions

Origin of living things has been controversial. From a biochemical point of view, living things are exceedingly elaborate enough to be considered intentionally be created. However, even when creation of present-day living things by extraterrestrials is accepted, entry of the first higher living thing somewhere in the universe with higher intelligent clearly happened by chance. Although complexity of present-day living things, which could not be generated by chance, is explained below, the first higher living thing should be considered to have been generated by chance. An answer for this seeming contradiction might be "I think, therefore there was." If there was no accident generating the first higher living thing, there is no existence considering such question here. In other words, "A higher living thing with ability to consider (a human) exists here, as a result of an accident which once generated a higher living thing in this universe."
The first higher living thing supposedly had a photosynthesis function because there would have been no convenient nutrients near the first higher living thing. However, the first higher living thing should be rather a simple being without decorative function, since it was generated by chance. For example, sexual reproduction is rather complex and unnecessary for existence of living things, compared with asexual reproduction. Sexual reproduction naturally requires sexual contact between males and females. Asexual reproduction is far easier for prosperity of tribes than sexual reproduction. If survival requires physical strength, increasing of muscles through 5-azacytidine, as mentioned below, is far easier than generating sexual reproduction system (explained below) by chance. Sexual reproduction is a typical decorative elaborate function and males are decorative new species. The first higher living thing seems to have developed science and created complex other living things with DNAs and additional decorative functions like sexual reproduction.
On the other hand, subjects which should not be confused are "origin of the first higher living thing" and "origin of various (decorative) species or functions." "Origin of the first higher living thing" clearly happened by chance. The subject to be considered is whether biological diversity was generated by chance or intentionally. In order to correctly consider this subject, mechanism of present-day living things and "cell differentiation" associated with "selective gene expression" should be learned. Growth starts from an egg cell (an ovum). Every cell is generated from the one egg cell and it naturally has potentiality to change into various cells. For example, a cell located in an eye can change into a cell of the eye. A cell located in a bone can change into a cell of the bone. A cell located in a liver can change into a cell of the liver. Cells can change into various cells of body tissues in accordance with its location. However, a cell located in an eye doesn't change into a cell of a bone or a cell of a liver. A bone or a liver is not formed in an eye. This is the "selective gene expression." This would probably be orchestrated through specific signal proteins or signal molecules. For example, a molecule called "5-azacytidine" changes "10T1/2 cell" into "myoblast (precursor of a muscle cell)." In other words, "5-azacytidine" changes a young cell into a muscle cell.
* "Conversion of 10T1/2 to Myoblast in Cell 1986" http://www.cell.com/abstract/0092-8674(86)90507-6
* "Conversion of 10T1/2 to Myoblast in Cell 1986 from Science Direct" http://www.sciencedirect.com/science/article/pii/0092867486905076
* "Myoblast in Wikipedia" http://en.wikipedia.org/wiki/Myoblast
This may be called transformation of cells. As explained above, mere chemicals could affect transformation of cells. However, transformation of cells during growth is mostly orchestrated by DNAs. Eggs of doves grow as doves, eggs of turtle grow as turtles, and they don't grow as muscle monsters. 5-azacytidine is rather created as signal molecules by DNAs for example specifically in cells beside legs and consequently muscle cells are formed on proper sites (for example, beside the legs). DNAs direct to form muscle cells along legs, but it doesn't direct to form muscle cells in brains.
Transformation of cells and alteration in appearance are formed in accordance with directions from DNAs. However, if cells on a back or arms change into cells of wings, the living thing can be a bird or other flying being. It is called "mutation." In this case, a new species appears and it results in biological diversity. On the other hand, if cells in a liver or in a brain change into cells of wings, the living thing is hard to survive long. If there was no intention for mutation programmed on DNAs in advance, such mutation occurs at random. It is similar to randomization on DNAs by radiation exposure, which usually results in radiation injury. In addition, if there was no intention in advance (if there was no creation), a male should have been generated from a female by chance. (From an evolutionary point of view, females producing eggs would be the basic beings rather than males.) This means loss of asexual reproduction and division or creation of the complementary new species "male" with spermatozoa, "sexual reproduction," happened by chance, though asexual reproduction or cloning has no harm to live.
If one would claim the theory of Evolution, it should be explained how "decorative functions" such as "sexual reproduction" happened by chance altering DNAs. The following are knowledge for detailed consideration whether living things on the Earth were generated by chance or not (created).

DNAs
*Attribution: http://en.wikipedia.org/wiki/File:ADN_animation.gif

2.1.12.2.2 Outline of Knowledge for Detailed Consideration

Doubtfulness of evolution would rise from knowledge of "Atom (non-existence of soul)," "Natural Law of Disorder Increases," "Organic Chemistry," and "Biochemistry." Outlines of organic chemistry and biochemistry particularly in reference to DNAs should be learned to think about credibility of evolution.

2.1.12.2.3 Atoms (Non-Existence of Soul)

First, some people believe existence of souls. Physicists have looked for origin of this world, what composes this world. Then what they found as components of this world are atoms. Furthermore, atoms consist of protons, neutrons, and electrons. (elementary particles to be precise) Physical elements associated with souls or spirits were not found. Living things consist of atom as well. Living things are things like SONY AIBO. AIBO seems as if he had will and soul. However, AIBO merely consists of atoms. Will, soul, and consciousness are just phenomena that came from atoms.

SONY AIBO following a Pink Ball
*Attribution: http://en.wikipedia.org/wiki/File:AIBO_ERS-7_following_pink_ball_held_by_child.jpg
* "AIBO in Wikipedia" https://en.wikipedia.org/wiki/AIBO

2.1.12.2.4 Natural Law of Disorder Increases

If there is no intervention of living things particularly of humans, well-ordered useful physical existence will naturally be disordered and changes into useless disordered existence. For example, mechanical wristwatches are useful well-ordered physical existence to show accurate time. However, they become inaccurate in accordance with time course, if there is no intervention of life forms (humans). Physical existence naturally changes into useless disordered existence. It never usefully autonomously improve itself. Disorder (degree of uselessness) of physical existence naturally increases (except for living things). This is an obvious natural law, which could be observed everywhere.
This was traditionally theorized as "Entropy Increases" in the second law of thermodynamics and statistical mechanics.
*"Entropy in Wikipedia" http://en.wikipedia.org/wiki/Entropy

2.1.12.2.5 An Outline of Organic Chemistry to be Learned

2.1.12.2.5.1 Introduction to Organic Chemistry

Things at least to be learned in reference to organic chemistry to understand doubtfulness of evolution are "atoms," "alcohols," "carboxylic acids," "amines," and "amino acids."

2.1.12.2.5.2 Hydrocarbons and Alcohols

Hydrocarbons are typical basic form of organic compounds. (Organic compounds are chemical compound (substance) mostly consisting of carbon.)
For example, "Propane," which consists of 3 carbons and 8 hydrogens is one of the most basic hydrocarbons.


A further basic form of organic compounds would be Oxygen-containing Organic Compounds.
When a "H" of Propane is replaced with a "OH," it would be Propyl Alcohol. Propyl Alcohol would be an example of Oxygen-containing Organic Compounds.


2.1.12.2.5.3 Carboxylic Acids

Carboxylic acids are typical acids from alcohols generally represented by the formula R-COOH. ("R" in the formula is an alkyl group and so on.)
* "Structure of a Carboxylic acid from Wikipedia" http://en.wikipedia.org/wiki/File:Carboxylic-acid.svg
*"Carboxylic acid in Wikipedia" http://en.wikipedia.org/wiki/Carboxylic_acid
Propionic Acid could be an example of Carboxylic Acids.


2.1.12.2.5.4 Amines

When one carbon of a hydrocarbon is replaced by one nitrogen, this is an "amine" typically represented by the formula R-NH₂.
* "Structure of a typical Amine from Wikipedia" http://en.wikipedia.org/wiki/File:Ethylamine-2D-flat.png
*"Amine in Wikipedia" http://en.wikipedia.org/wiki/Amine
Ethylamine could be an example of Amines. (Oxygen is not an essential element for now.)


2.1.12.2.5.5 Amino Acids

Amino acids in living things are organic compounds including (at least) both a carboxylic acid group and an amine group.
*"Amino acid in Wikipedia" http://en.wikipedia.org/wiki/Amino_acid
Glycine would be the simplest example of Amino Acids.


2.1.12.2.6 An Outline of Biochemistry to be Learned

2.1.12.2.6.1 Introduction to Biochemistry

Things at least to be learned in reference to biochemistry to understand doubtfulness of evolution are "proteins," "enzymes," "cells," "various cell substances," "cell nucleuses," "DNAs," "RNAs," "protein biosynthesis by DNA and RNA," and "cell cycle" including "cell division."
* "Biology Project Arizona" http://www.biology.arizona.edu/DEFAULT.html
Basic concept of cells could be explained in the following website.
* "Cell Tutorial Arizona" http://www.biology.arizona.edu/cell_bio/tutorials/cells/cells.html
There are 2 types of cells. Prokaryotic cells and Eukaryotic cells. Prokaryotic cells are simple, while peculiar to primitive bacteria and they digress from the main subject. Eukaryotic cells are common in most other living things including humans. The following descriptions are mostly on Eukaryotic cells.

2.1.12.2.6.2 Protein

A protein consists of plenty of amino acids. Amino acids are connected forming a chain. When the chain of amino acids is short, it is called "peptide." When the chain of amino acids is long, it is called "protein." The structure of proteins should be learned in the following Chemguide website.

An Example of Peptides
*Attribution: https://en.wikipedia.org/wiki/File:Tetrapeptide_structural_formulae_v.1.png
★ "Chemguide Protein Structure" http://www.chemguide.co.uk/organicprops/aminoacids/proteinstruct.html
*"Protein in Wikipedia" http://en.wikipedia.org/wiki/Protein
There are a vast variety of proteins.

2.1.12.2.6.3 Enzyme

Some (yet a vast variety of) proteins have specific functions to create organic compounds of various cell substances. Tyey are called "Enzymes." (Number of kinds of enzymes in human body is said to be 5,000. Number of kinds of enzymes on the Earth is said to be over 25,000.) For example as an enzyme, "aspartate - ammonia ligase" (another name: "asparagine synthetase") creates asparagine (a kind of amino acids) from aspartate (salt of aspartic acid (another kind of animo acids)) and ammonia. ("-ase" is generally the suffix for enzymes.) (Reaction: ATP + L-aspartate + NH₃ => AMP + diphosphate + L-asparagine; this reaction requires energy supply. ATP (adenosine triphosphate) supplies energy changing into AMP (adenosine monophosphate).) Thus all of the various cell substances are created through various enzyme reactions.
★ "Chemguide Proteins as Enzymes" http://www.chemguide.co.uk/organicprops/aminoacids/enzymes.html#top


An Enzyme binding 2 molecules
*Attribution: https://en.wikipedia.org/wiki/File:Hexokinase_induced_fit.svg

2.1.12.2.6.4 Protein Biosynthesis

2.1.12.2.6.4.1 Outline

On the other hand, enzymes (and proteins) are created through Protein Biosynthesis in the cell. Protein biosynthesis consists of 2 processes. The first process is "Transcription" in cell nucleuses. The second process is "Translation" on the outside of the nucleus. Members of protein biosynthesis are illustrated in the following image.

*Attribution https://commons.wikimedia.org/wiki/File:MRNA-interaction.png

Transcription is the process to create "messenger RNAs" copying "base sequences" or "codons" from DNAs. The members for transcription are DNAs, RNA nucleotides, and RNA polymerase. They create messenger RNAs. A nucleus packed with a nuclear envelope generally lies in a cell (an eukaryotic cell). A nucleus holds most genetic substances such as nucleoplasm (liquid), DNAs, RNAs (transfer RNAs), nucleoproteins, various enzymes, and a nucleolus (a particle creating robosomes). Nucleoproteins form complexes with DNAs and RNAs (respectively) such as chromatin. The nuclear envelopes have selective nuclear pores to allow selective movement of specific molecules. On the other hand, ribosomes lie on the outside of the nucleus.
Translation is the process to synthesize proteins connecting amino acids which are collected and arranged by transfer RNAs in accordance with the codons on the messenger RNAs.

2.1.12.2.6.4.2 Structure and Composition of Cells

Prior to details of protein biosynthesis, outline of cells should be learned. Structure of a cell including a nucleus is illustrated in the image below.

The size (length) of human cells is about 10 μm on average. Ova are generally large and the size (length) of human ova is about 100 μm.
The outerwall of the cell is the cell membrane. The cell membrane envelops various essential substances (contents). The inside of the cell membrane is mostly filled with aqueous liquid called "intracellular fluid" or "cytosol." The space outside the cells, between the cells, is filled with extracellular fluid.
* "Cytosol in Wikipedia" http://en.wikipedia.org/wiki/Cytosol
* "Extracellular Fluid in Wikipedia" https://en.wikipedia.org/wiki/Extracellular_fluid

The most essential substance is "nucleus."
The outerwall of the nucleus is the nuclear envelope. The nucleus includes DNAs and so on. DNAs are sometimes in the shape of Chromosomes.
The other essential substances would be ribosomes attached to endo plasmic reticulums and mitochondria.
Inside of a cell is covered with fibrous substances such as (a) microtubules, (b) microfilaments (such as actin filaments), and (c) intermediate filaments. The ends of the fibrous substances stick to cell membranes or other substances such as the nucleus, the fibrous substances support the shape of the cells or the position of the substances such as the nucleus in the cell or change the shape of the cells. The structure consisting of the fibrous substances is called cytoskeleton.
The space outside the cells, between the cells, is supported by extracellular matrix such as integrins. The extracellular matrix sometimes stick to cell membranes, supports position of the cells.
* "Cytoskeleton in Wikipedia" https://en.wikipedia.org/wiki/Cytoskeleton
* "Extracellular Matrix in Wikipedia" https://en.wikipedia.org/wiki/Extracellular_matrix
* "Integrin in Wikipedia" https://en.wikipedia.org/wiki/Integrin

All cell substances are mostly complexes of water, proteins, lipids, carbohydrates, and suchlike. All cell substances are mostly created through enzyme reaction. Enzymes are created through protein biosynthesis, since enzymes are a kind of proteins.

Animal Cell Structure
Organelles are labelled as follows:
1. Nucleolus 2. Nucleus 3. Ribosome (the dots) 4. Vesicle 5. Rough endoplasmic reticulum 6. Golgi apparatus (or "Golgi body") 7. Cytoskeleton 8. Smooth endoplasmic reticulum 9. Mitochondrion 10. Vacuole 11. Cytosol 12. Lysosome 13. Centriole 14. Cell membrane
*Attribution: http://en.wikipedia.org/wiki/File:Animal_Cell.svg

* "Cell (Biology)" https://en.wikipedia.org/wiki/Cell_(biology)

2.1.12.2.6.4.3 DNA

One DNA is like a strand with short branches. Two DNAs form a twisted long ladder (a double-stranded helix). The two DNAs consist of two long polymers (two strands), while many rungs connect the two polymers (two strands) like a ladder.

DNA Structure
*Attribution: http://en.wikipedia.org/wiki/File:DNA_Structure%2BKey%2BLabelled.pn_NoBB.png

The ladder of the two DNAs would be simplified as follows.     



"Sugar" in this case is "deoxyribose." "Deoxyribose" is a modified ribose. "Ribose" is a simple sugar containing 5 carbons. It's 150 molecular mass in weight. (For reference for example, molecular mass of sucrose (the typical sugar in kitchens) is 342. Ribose is half of ordinary sugar (sucrose) in molecular mass weight.)
Solid lines of above illustration mean "covalent bond." Dotted lines above mean "ionic bond."
"Base" in this case is "base in chemistry," the opposite of acid. "Base" particularly in this case is either Adenine, Thymine, Guanine, or Cytosine. These are cyclic nitrogen compounds. Adenine and Thymine tend to adhere each other. Guanine and Cytosine tend to adhere each other. Then, above "Base - - - - Base" means a ionic bond combination of "Adenine - - - - Thymine," "Thymine - - - - Adenine," "Guanine - - - - Cytosine," or "Cytosine - - - - Guanine." These are usually referred to as "A-T," "T-A," "G-C," and "C-G."
"Phosphate ester" in this case is in a sense a mere connector.
* "DNA Structure Chemguide" http://www.chemguide.co.uk/organicprops/aminoacids/dna1.html

2.1.12.2.6.4.4 Nucleoside

A compound, one "Sugar" and one "Base" are just bound like below, is "nucleoside."

         

2.1.12.2.6.4.5 Nucleotide

A compound to which phosphoric acid is added like below is "nucleotide." Nucleotide is the fundamental unit of genetics. The sugar can be either deoxyribose or ribose. Both cases can be called "nucleotide." When the sugar is "deoxyribose," nucleotide is part of DNA and the "Base" is either A, T, G, or C.
When the sugar is "ribose," the nucleotide is called "RNA nucleotide" and the "Base" is either Adenine, Uracil, Guanine, or Cytosine. Uracil is an analog of Thymine and available in RNA system instead of Thymine unlike in DNA system. This is an exception of similarity between DNA and RNA like deoxyribose and ribose. In addition, in contrast to DNA, RNA usually doesn't form bound strands.
"Deoxyribose" and "ribose" have 5 carbons. Each carbon is numbered. A phosphoric acid is added to the 5th carbon in a nucleotide. The direction where phosphoric acid is added is called "5' end" or "5'". Another phosphoric acid of a nucleotide would adhere to the 3rd carbon to form nucleotide chain. Then the opposite direction is called "3' end" or "3'". 5' end or 3' end could be illustrated upward, downward, to the left, or to the right depending on the situation.
         
2.1.12.2.6.4.6 RNA

When the sugar is "ribose" (not deoxied) and a strand is formed like below, the strand is called "RNA (Ribo Nucleic Acid)." In other words, "RNA" is a chain of "RNA nucleotides." When "RNA nucleotides" are connected, they will be "RNA."
      
There are roughly 3 kinds of major RNAs as mentioned below, "messenger RNA," "ribosome RNA," and "transfer RNA." Messenger RNA is a simple strand of RNA.

2.1.12.2.6.4.7 Transcription

2.1.12.2.6.4.7.1 Introduction

The first process to synthesize protein is transcription creating "messenger RNAs" in cell nucleuses. Creation of "messenger RNA" (transcription) consists of two steps.
The first step of transcription is creating "heterogeneous nuclear RNAs (hn RNAs)" copying "base sequences" or "3-base sequences" from DNAs. Then the second step of transcription (posttranscriptional processing) is to change hn RNAs into "messenger RNAs (m RNAs)."
The members for the first step of transcription (creating hn RNAs) are DNAs, RNA nucleotides, RNA polymerase II, and other proteins called "transcription factors" in cell nucleuses (in nuclear envelopes). They create heterogeneous nuclear RNAs connecting RNA nucleotides.
(There are 3 kinds of RNA polymerases. RNA polymerase II corresponds to messenger RNA (hn RNA, to be exact). On the other hand, RNA polymerase I corresponds to ribosomal RNA. RNA polymerase III corresponds to transfer RNA and so on.)
A double-stranded helix of two DNAs is for example as follows. One strand of the two DNAs is called "coding strand" (or "sense strand"), when its 3-base sequences respectively basically designate each amimo acid of protein to synthesize and the strand is meaningful. For example, a sequence AAC designates asparagine. GAC designates aspartic acid. ATG designates methionine. Such 3-base sequence which designates a certain specific amino acid is called "codon." (To be precise, "codon" is 3-base sequence on RNA as "RNA codon table" is mentioned below.) In addition, there are some specific sequences. For example as mentioned below, ACATTTG means initial site of the transcription of human β globin (protein of blood hemoglobin).
The other strand of the two DNAs is called "template strand" (or "noncoding strand" or "antisense strand"), since its base sequences are merely complementary to base sequences of the coding strand. Its base sequences naturally don't correspond to animo acids. However, the template strand is employed as the template during the transcription to produce messenger RNA on which the base sequences of the coding strand are copied. For example, when the base sequence of the coding strand is "AAC," the base sequence of template strand is "TTG" in accordance with the complementary relationship. Then, messenger RNA will be created as "AAC" like the original sequence, the sequence of the coding strand.
 

The first step of transcription creating hn RNA consists of 3 stages, "initiation," "elongation," and "termination." Then the second step of transcription (posttranscriptional processing) changing hn RNA into messenger RNA consists of 3 stages, "5' cap addition," "3' polyadenylation," and "splicing."

2.1.12.2.6.4.7.2 Initiation of Transcription

The initiation stage starts finding "promoter" region on the coding strand and adhering (clinging) of various proteins (enzymes) including RNA polymerase II there.
Thickness of a double-stranded helix DNA is rather thin as its molecular structure can be illustrated. On the other hand, RNA polymerase II and other proteins consist of enormous amino acids. A RNA polymerase II and other proteins adhere (cling) beside a double-stranded helix DNA.
"Core promoters" are particularly essential base sequences in promoter regions. TATA box and CAAT box are typical examples of "core promoters." A transcription start site (TSS) where transcription will be started is usually found scores of base pairs downstream (in the direction of 3' end) from a core promoter on the coding strand.
There often could be a base sequence of "TATAAAA" on the coding strand (sequence of TATAAAA from 5' end to 3' end). This sequence is called "TATA box," a typical "core promoter." A protein called "Transcription Factor IID (TFIID)" finds and adheres to the core promoter such as TATA box facilitated by TFIIA. TFIID mediates adhering (clinging) of TFIIB (a kind of protein) beside the core promoter. TFIIF takes RNA polymerase II to adhere downstream (in the direction of 3' end on the coding strand) adjacent to the core promoter of the DNA, consequently close to the TSS. In addition, TFIIE, TFIIH, and TFIIJ adhere to the RNA polymerase II.
* "Chemguide Transcription from DNA to RNA" http://www.chemguide.co.uk/organicprops/aminoacids/dna3.html

If the promoter is TATA box, the transcription start site (TSS) lies 20-25 downstream (in the direction of 3' end of coding strand) from the TATA box. TFIIH starts to partially or temporarily split (unwind) the double-stranded helix DNA into two strands, the coding strand and the template strand, at the promoter site beside its body. The RNA polymerase II proceeds beside along the DNA, continuing to partially or temporarily split the DNA to a certain length (length corresponds to 10 nucleotides), and "recognition protein in RNA polymerase II" works as if recognizing sequences of the DNA though it is a mere chemical substance with no intelligence.

A concrete example of human β globin (a protein of red blood cells) DNA code is shown below.
The following blue "CATAAAA" is a variety of TATA box, a core promoter. The subsequent green "ACATT" is the transcription start site (TSS). Sequences beyond TSS will be transcripted to hn RNA. The subsequent red "ATG" is the signal of the announcement of the first codon where protein synthesis starts. This "ATG" and the subsequent orange sequence "GTG, CAC, CTG, ......, GGC, AGG" is then meaningful codons which designate sequence of 30 amino acids of the protein to be synthesized. (AGG designates the 30th amino acid.) Such meaningful sequences of codons are called "exon." Consequently, the region from above green TSS through before ATG is transcripted, but untranslated into amino acids. Then the region is called "5' untranslated region (5' UTR)." The next black sequence "TTGGTA ...... TTAGG" is meaningless. Such meaningless sequences laid in meaningful regions are called "intron" or "intervening sequence." The next orange sequence "CTG, CTG, GTG, ......, AGG" is meaningful exon which designates from the 31st amino acid through 104th amino acid. The first CTG designates the 31st amino acid. The next orange sequence "CTC, CTG, ..." is the third exon, which designates from the 105th amino acid through the 146th amino acid. The last red "TAA" announces the termination of animo acid designation. The next green "GCTC... " are not destined to be translated into amino acids. It is called "3' untranslated region (3' UTR)." The blue sequence "AATAAA" is the site where "3' polyadenylation tail" will be added. The subsequent green sequence which ends with "....CATTGC" is 3' untranslated region as well. The last black sequence "AATGAT......." is meaningless intron.

CCCTGTGGAGCCACACCCTAGGGTTGGCCA ATCTACTCCCAGGAGCAGGGAGGGCAGGAG CCAGGGCTGGGCATAAAAGTCAGGGCAGAG CCATCTATTGCTTACATTTGCTTCTGACAC AACTGTGTTCACTAGCAACCTCAAACAGAC ACCATGGTGCACCTGACTCCTGAGGAGAAG TCTGCCGTTACTGCCCTGTGGGGCAAGGTG AACGTGGATGAAGTTGGTGGTGAGGCCCTG GGCAGGTTGGTATCAAGGTTACAAGACAGG TTTAAGGAGACCAATAGAAACTGGGCATGT GGAGACAGAGAAGACTCTTGGGTTTCTGAT AGGCACTGACTCTCTCTGCCTATTGGTCTA TTTTCCCACCCTTAGGCTGCTGGTGGTCTA CCCTTGGACCCAGAGGTTCTTTGAGTCCTT TGGGGATCTGTCCACTCCTGATGCTGTTAT GGGCAACCCTAAGGTGAAGGCTCATGGCAA GAAAGTGCTCGGTGCCTTTAGTGATGGCCT GGCTCACCTGGACAACCTCAAGGGCACCTT TGCCACACTGAGTGAGCTGCACTGTGACAA GCTGCACGTGGATCCTGAGAACTTCAGGGT GAGTCTATGGGACCCTTGATGTTTTCTTTC CCCTTCTTTTCTATGGTTAAGTTCATGTCA TAGGAAGGGGAGAAGTAACAGGGTACAGTT TAGAATGGGAAACAGACGAATGATTGCATC AGTGTGGAAGTCTCAGGATCGTTTTAGTTT CTTTTATTTGCTGTTCATAACAATTGTTTT CTTTTGTTTAATTCTTGCTTTCTTTTTTTT TCTTCTCCGCAATTTTTACTATTATACTTA ATGCCTTAACATTGTGTATAACAAAAGGAA ATATCTCTGAGATACATTAAGTAACTTAAA AAAAAACTTTACACAGTCTGCCTAGTACAT TACTATTTGGAATATATGTGTGCTTATTTG CATATTCATAATCTCCCTACTTTATTTTCT TTTATTTTTAATTGATACATAATCATTATA CATATTTATGGGTTAAAGTGTAATGTTTTA ATATGTGTACACATATTGACCAAATCAGGG TAATTTTGCATTTGTAATTTTAAAAAATGC TTTCTTCTTTTAATATACTTTTTTGTTTATC TTATTTCTAATACTTTCCCTAATCTCTTTC TTTCAGGGCAATAATGATACAATGTATCAT GCCTCTTTGCACCATTCTAAAGAATAACAG TGATAATTTCTGGGTTAAGGCAATAGCAAT ATTTCTGCATATAAATATTTCTGCATATAAA TTGTAACTGATGTAAGAGGTTTCATATTGC TAATAGCAGCTACAATCCAGCTACCATTCT GCTTTTATTTTATGGTTGGGATAAGGCTGG ATTATTCTGAGTCCAAGCTAGGCCCTTTTG CTAATCATGTTCATACCTCTTATCTTCCTC CCACAGCTCCTGGGCAACGTGCTGGTCTGT GTGCTGGCCCATCACTTTGGCAAAGAATTC ACCCCACCAGTGCAGGCTGCCTATCAGAAA GTGGTGGCTGGTGTGGCTAATGCCCTGGCC CACAAGTATCACTAAGCTCGCTTTCTTGCT GTCCAATTTCTATTAAAGGTTCCTTTGTTC CCTAAGTCCAACTACTAAACTGGGGGATATT ATGAAGGGCCTTGAGCATCTGGATTCTGCC TAATAAAAAACATTTATTTTCATTGCAATG ATGTATTTAAATTATTTCTGAATATTTTAC TAAAAAGGGAATGTGGGAGGTCAGTGCATT TAAAACATAAAGAAATGAAGAGCTAGTTCA AACCTTGGGAAAATACACTATATCTTAAAC TCCATGAAAGAAGGTGAGGCTGCAAACAGCT AATGCACATTGGCAACAGCCCTGATGCCTA TGCCTTATTCATCCCTCAGAAAAGGATTCA AGTAGAGGCTTGATTTGGAGGTTAAAGTTT TGCTATGCTGTATTTTACATTACTTATTGT TTTAGCTGTCCTCATGAATGTCTTTTCACT ACCCATTTGCTTATCCTGCATCTCTCAGCC TTGACTCCACTCAGTTCTCTTGCTTAGAGA TACCACCTTTCCCCTGAAGTGTTCCTTCCA TGTTTTACGGCGAGATGGTTTCTCCTCGCC TGGCCACTCAGCCTTAGTTGTCTCTGTTGT CTTATAGAGGTCTA……

RNA polymerase II (RNAP) accompanied by TFIIE, TFIIH, and TFIIJ moves along a double-stranded helix DNA pushing aside ionic bonds. On the other hand, TFIID, TFIIA, and TFIIB remain at the core promoter. This division is called "clearance." Once RNA polymerase II recognizes the TSS, RNA polymerase II starts to obtain and place complementary RNA nucleotides to the recognized bases on the template strand. Thus RNA chain is created along the template strand. If the recognized base on the template strand is G (the complementary corresponding base on the coding strand is C), RNA polymerase II places C-RNA nucleotide on the G. If the recognizing base on the template strand is A (the complementary corresponding base on the coding strand is T), RNA polymerase II places U-RNA nucleotide on the A.
Splitted length of the double-stranded helix DNA is limited. In accordance with the forward movement of RNA polymerase II, the splitted strands (bases) left behind are bound and normal double-stranded helix DNA is recovered.


* https://en.wikipedia.org/wiki/File:Simple_transcription_elongation1.svg

2.1.12.2.6.4.7.3 Elongation of Transcription

Elongation is the stage to obtain, place, and connect RNA nucleotides at the RNA polymerase II, lengthen RNA chain, and create hn RNA chain (strand).

2.1.12.2.6.4.7.4 Termination of Transcription

When sequences for termination are recognized, transcription ends. Thus hn RNA chain (strand) is created. A hn RNA is a copy of the coding strand from the TSS to the terminal region, while T of DNA is replaced by U in RNA. Referring to the above example, hn RNA begins with "ACATTTG..." and ends with "...CATTGC."

2.1.12.2.6.4.7.5 Capping and Poly A Addition

Thus hn RNA is created and it will be protected from enzymatic degradation by 5' Capping and 3' Polyadenylation.
5' Capping is the stage to add "cap structure" to 5' end of hn RNA so as to protect 5' end of hn RNA.
* "5' cap Wikipedia" http://en.wikipedia.org/wiki/5'_cap
3' Polyadenylation is the stage to add "Poly (A) tail" to 3' end of hn RNA so as to protect 3' end of hn RNA. For example, Poly (A) tail is added at AATAAA in the above example.
* "Polyadenylation in Wikipedia" http://en.wikipedia.org/wiki/Polyadenylation

2.1.12.2.6.4.7.6 RNA Splicing

Splicing is the stage to remove introns. Then a hn RNA changes into a messenger RNA chain (strand).
* "RNA Splicing in Wikipedia" http://en.wikipedia.org/wiki/RNA_splicing

2.1.12.2.6.4.8 Translation

2.1.12.2.6.4.8.1 Introduction

Translation is the process to synthesize proteins at ribosomes, on the outside of the cell nucleuse.
* "Chemguide Protein Synthesis from mRNA to a Protein Chain" http://www.chemguide.co.uk/organicprops/aminoacids/dna5.html
Members for translation are "messenger RNAs," "transfer RNAs," and "ribosomes."
Messenger RNAs created in the nucleus move to the outside of the nucleus through nuclear pores.
Ribosomes are complexes of proteins and ribosomal RNAs. Ribosomes consist of 2 subunits. Ribosomal RNAs are created by RNA polymerases and so on like messenger RNAs.
* "Ribosome in Wikipedia" http://en.wikipedia.org/wiki/Ribosome
* "Role of Ribosome" http://www.cytochemistry.net/cell-biology/ribosome.htm
Transfer RNAs are mostly made of RNA strands. (Transfer RNAs are created by RNA polymerases and so on like messenger RNAs.) Specifically, transfer RNAs have cloverleaf secondary structure. They have specific 3-base sequence called "anticodon." Anticodon is destined to correspond to codon of messenger RNA. For example, transfer RNA with anticodon "GCA" is destined to meet "CGU" codon of messenger RNA. In addition, transfer RNAs have a specific amino acid respectively at the 3' end in accordance with the RNA codon table.
When the anticodon of a transfer RNA is CUU, the corresponding codon on messenger RNA is GAA and a glutamic acid is bound to the teansfer RNA in accordance with the RNA codon table.
* "Transfer RNA in Wikipedia" http://en.wikipedia.org/wiki/Transfer_RNA
* "RNA Codon Table in Wikipedia" http://en.wikipedia.org/wiki/Genetic_code#RNA_codon_table

2.1.12.2.6.4.8.2 Initiation of Translation

First, a small subunit of a ribosome adheres to a messenger RNA. An initiator transfer RNA, which has UAC anticodon and methionine in accordance with the RNA codon table, finds complementary AUG codon on the messenger RNA and adheres there. (Methionine is a kind of amino acids.) (ATG was explained as the first 3-base sequence to be translated in ptotein synthesis from DNA of human β globin as mentioned above. It means AUG is the first codon on RNA to be translated. AUG is the signal to start translation.) Then a large subunit of a ribosome adheres to the small subunit holding the messenger RNA. Ribosomes have 2 sites for transfer RNAs. One is called "A site." The other is called "P site." The first transfer RNA with methionine sits on the "A site."

2.1.12.2.6.4.8.3 Elongation of Translation

The messenger RNA is transported for one codon (3-base) in length in the ribosome along with the first transfer RNA bound to the messenger RNA. The first transfer RNA is transferred from the "A site" to the "P site." The "A site" gets empty and the next transfer RNA complementarily corresponds to the next codon on the messenger RNA adheres to the "A site." If the second codon on the messenger RNA is CCG, the second transfer RNA with GGC anticodon has proline. Then the methionine and the proline are bound. Thus amino acids are bound. Next, the messenger RNA is transported for one codon in length. The transfer RNA with UCA anticodon sat on the "P site" leaves and the transfer RNA with GGC anticodon on the "A site" moves to the "P site." Subsequently, the next transfer RNA comes, the new amino acid is bound to proline, and the animo acid chain is elongated. When the chain is short, it is called "peptide." When the chain is long, it is called "protein."


Schematic of Peptide/Protein Synthesis
*Attribution: https://en.wikipedia.org/wiki/File:Peptide_syn.svg

2.1.12.2.6.4.8.4 Termination of Translation

As shown in the RNA codon table or summarized as "stop codon," UAA, UAG, and UGA are "stop codons."
* "Stop Codon in Wikipedia" http://en.wikipedia.org/wiki/Stop_codon
When a stop codon comes to the ribosome, the translation terminates. Thus a protein is completed. Some proteins such as enzymes are functional to create organic compounds of various cell substances or cause changes, activity, and transformation of cells and forms.

2.1.12.2.6.5 Transportation, Motion, and Transmission

Thus proteins and enzymes are created. However, proteins, enzymes, and other substances created through enzymes should be moved to proper location in the cell (or outside the cell). Many substances would be moved simply through diffusion. Yet specific substances would be moved through motor proteins along cytoskeleton, fibrous substances in the cell, or in other ways.

Motor proteins are for example kinesins.
Kinesins move along microtubules. Kinesins bind to specific substances and move inside cells along microtubeles. For example, a kinesin bind to a mitochondrion and they would move along the microtubule in the cell.

Another example of a mechanism is stretch and contraction of actin filaments.
An actin is a type of protein, a single actin molecule has a molecular weight of approximately 42,000. It is square cushion-shaped, but can also be described as spherical (globular). When an actin molecule exists singly (square or spherical), it is called G-Actin (globular-actin).
Multiple G-Actins are linked together by the action of ATP (adenosine triphosphate) and others, form a filament (a fiber). The filament is called F-Actin (filamentous-actin) or Actin Filament. F-Actin further connects with other G-Actin through the action of ATP and others, the length of F-Actin (Actin Filament) increases. Conversely, a phenomenon occurs in which part of F-Actin becomes G-Actin and the length of F-Actin is shortened.
Actin filaments can be stretched and contracted in the cell. Therefore, parts of the cell membrane can protrude forming lamellipodia (temporary legs) or retract through actin filaments, the cell can move.

They stick to specific substances and move, then they carry the substances or deform the shape of the cell. They enable motion of cells including cell cycle and cell division.

Schematic View of Cytoskeleton
*Attribution: https://commons.wikimedia.org/wiki/File:Cytoskeleton_Components.png


Image of the Cytoskeleton in the cells.
A blue circle correspods to a Nucleus in a cell. Actin filaments are shown in red. Microtubules are shown in green.
* "Cytoskeleton in Wikipedia" https://en.wikipedia.org/wiki/Cytoskeleton


Animation of a Kinesin Moving along a Microtubule
* "Motor Protein in Wikipedia" https://en.wikipedia.org/wiki/Motor_protein
* "Kinesin in Wikipedia" https://en.wikipedia.org/wiki/Kinesin


Diagram of Conversion from G-Actin to F-Actin
* "Actin in Wikipedia" https://en.wikipedia.org/wiki/Actin


A Cell Forming Lamellipodia
* "Lamellipodium in Wikipedia" https://en.wikipedia.org/wiki/Lamellipodium

The extracellular matrix is sometimes responsible for signal transmission between the cells. Other substances are sometimes responsible for signal transmission between the cells.

2.1.12.2.6.6 Form of DNAs, Cell Cycle, and Diploid

The next knowledge to be learned would be cell division. However, form of DNAs should be set straight prior to cell division.
Two DNAs form a long double-stranded helix molecule composed of 2 strands as mentioned above. The cell nucleus of a cell of a human has 46 double-stranded DNAs. 23 double-stranded helix DNAs from the mother and 23 double-stranded helix DNAs from the father. It is called "diploid." The first double-stranded helix DNA from the mother and the first double-stranded helix DNA from the father are almost similar. They can be called a pair DNA or "homologous DNA." The second double-stranded helix DNA from the mother and the second double-stranded helix DNA from the father are almost similar. They can be called a pair DNA or "homologous DNA." Other DNAs are similar as well.
The 23rd double-stranded helix DNAs are associated with sex-determination and called "sex-determining DNAs."
The 23rd double-stranded helix DNA from the mother and the 23rd double-stranded helix DNA from the father in a cell of women are similar and they can be called a pair or "homologous DNA." The 23rd double-stranded helix DNAs of women are called "X-DNA." A cell of women has 2 double-stranded helix X-DNAs, one from the mother, the other from the father.
However, the 23rd double-stranded helix DNA from the mother and the 23rd double-stranded helix DNA from the father in a cell of men are somewhat different and they are not homologous, while they could be called in a sense a pair though. The 23rd double-stranded helix DNA of a cell of men from the mother is X-DNA. The other double-stranded helix DNA of the cell of men from the father is called "Y-DNA."
The 22 double-stranded helix DNA pairs (excluding the 23rd DNA) are called "autosomal pairs." The 23rd double-stranded helix DNA pair (sex-determining DNA pair) is called "allosomal pair."

23 Pairs of Human Male Double-stranded Helix DNAs in the Shape of Chromosome
*Attribution: http://en.wikipedia.org/wiki/File:NHGRI_human_male_karyotype.png

DNAs show some types in shape.

Shapes of DNA
from left to right
(1) DNA Double-Stranded Helix, (2) Nucleosome, (3) 10 nm "Beads-on-a-String" Chromatin Fibre,
(4) 30 nm Chromatin Fibre, (5) 30 nm Chromatin Fibre (wide view),
(6) Active Chromosome, (7) Active Chromosome (wide view),
(8) Metaphase Chromosome, (9) Metaphase Chromosome (wide view)
*Attribution: http://en.wikipedia.org/wiki/File:Chromatin_Structures.png

(1) A double-stranded helix DNA is basically a twisted long ladder.

(2) Nucleosome
On the other hand, since Human DNAs in a cell are some 2 m in total and they should be housed in a nucleus some 10 μm in diameter, double-stranded helix DNAs are commonly shrunken (wound). Double-stranded helix DNAs are shrunken (wound) mediated by Histone.
Histone is a kind of proteins. 8 molecules of histone form a "histone octomer." Double-stranded helix DNA usually winds itself around "histone octomers" and forms "nucleosome." Double-stranded helix DNA winds 2 turns around each histone octomer as nucleosome.

Nucleosome
*Attribution: http://en.wikipedia.org/wiki/File:Nucleosome_organization.png

* "Nucleosome in HubPages" http://nathanielzhu.hubpages.com/hub/Nucleosome-Structure-Part-1
* "Nucleosome in Wikipedia" http://en.wikipedia.org/wiki/Nucleosome

(3) Chromatin (10 nm Beads-on-a-String Chromatin Fibre)
A chain of nucleosomes is a chromatin. Then the length of double-stranded helix DNA is shortened in the shape of nucleosome or chromatin. Nucleosomes firstly form 10nm Beads-on-a-String Chromatin Fibre.
10 nm Beads-on-a-String Chromatin Fibre is active in transcription (protein synthesis), supposedly because DNAs are partly wound and strings are still quite exposed.

Beads-on-a-String
*Attribution: http://en.wikipedia.org/wiki/File:Chromatin_Structures.png

(4) Chromatin (30 nm Chromatin Fibre)
When 10 nm Beads-on-a-String Chromatin Fibre is furthermore wound, it would be 30 nm Chromatin Fibre.
30 nm Chromatin Fibre is less active in transcription (protein synthesis), supposedly because double-stranded helix DNA string is less exposed.
Since Nucleosomes partly stick to double-stranded helix DNAs, Nucleosomes partly oppose DNA transcription. Then it should be noted that situation of Nucleosomes or Chromatin affects specific transcription, protein biosynthesis, and consequently determines cellular property.

(6) Active Chromosome
Scaffold proteins are added and Active Chromosome is formed.

(8) Metaphase Chromosome
Additional scaffold proteins are added and Metaphase Chromosome is formed. Metaphase is the stage just before cell division. Metaphase Chromosome is ready to be divided.

*Attribution: http://en.wikipedia.org/wiki/File:Metaphase.svg

Form of DNAs or chromatins changes in accordance with the cell cycle (the life cycle of cells). The cell cycle is explained in the following site.
* "Cell Cycle Arizona" http://www.biology.arizona.edu/cell_bio/tutorials/cell_cycle/cells2.html
The cell cycle includes mitosis (ordinary cell division) and the phases of mitosis are explained in the following site.
* "Mitosis Arizona" http://www.biology.arizona.edu/cell_bio/tutorials/cell_cycle/cells3.html

G1 Phase (Growth1/ Gap1)
At the begining of the G1 Phase, just after the mitosis (cell division), double-stranded helix DNAs (chromatins) are shrunken forming "chromosomes" as remains of the cell division.
A "chromosome" is shrunken double-stranded helix DNA or shrunken chromatin in the shape of a thick short stick. In this case, a chromosome is not in the shape of an "X" but in the shape of an "I" (or rather bent and in the shape of "c"). Double-stranded helix DNA or chromatin was shrunken as "chromosome" since the short compact form of the chromosome was convenient for the prior cell division. It should be noted that "chromosome" is just a temporary form of double-stranded helix DNA in cell division. (The term "chromosome" came from Greek "color" since it was easily dyed and found as a dyed substance through biochemical experiments.)
In the middle period of G1 Phase in the cell cycle, chromosome structure is elikinated and double-stranded helix DNAs are in the shape of chromatin, "Beads-on-Strings."

Mitotic Cell Cycle
*Attribution: http://en.wikipedia.org/wiki/File:Animal_cell_cycle.svg

S Phase (DNA Synthesis)
When the cell enters the S Phase (the period for DNA synthesis), histone octomers tentatively depart from double-stranded helix DNA for the process of DNA replication, but nucleosome structure (chromatin) is soon recovered on the replicated DNAs. After the replication of DNAs, a cell has 46 × 2 = 92 double-stranded helix DNAs.

G2 Phase (Growth2/ Gap2)
Then the cell enters growth phase again.

M Phase (Mitotic Phase)
When the cell enters the M Phase (the period of cell division), 92 DNAs or chromatins change into chromosomes. In this case, replicated 2 double-stranded helix DNAs form one X shape chromosome. (One X shape chromosome consists of 2 double-stranded helix DNAs.) Then a cell has 46 X shape chromosomes. Subsequently, 46 X shape chromosomes are separated into 92 I shape chromosomes, 46 I shape chromosomes move to each edge respectively for new cells. Then a new cell at the begining of G1 Phase, just after mitosis (cell division), has 46 I shape chromosomes.
By the way, again, it should be noted that "X shape chromosome" and "X-DNA (the 23rd DNA)" are different things. In addition, when "X-DNA (the 23rd double-stranded helix DNA)" forms chromosome, it is called "X-chromosome." However, "X-chromosome (chromosome form of the 23rd double-stranded helix DNA)" and "X shape chromosome" are different things.

2.1.12.2.6.7 Cell Division 1 (Mitosis)

Cell division to increase number of cells is essential to grow or maintain body tissues since cells guradually die due to life span of cells or injury on cells. Cell divisions are accumulations of various reactions by enzymes, originally by protein biosynthesis as mentioned above. Cell divisions are the process to divide a cell into 2 or more cells to increase number of cells. Cell divisions include 2 types. One is "mitosis." The other is "meiosis." "Mitosis" is the ordinary cell division, which creates 2 cells (called 2 "daughter cells") identical to the original cell (called "parent cell") dividing the original one cell (parent cell).
("Meiosis" mentioned later is the special cell division, which creates reproductive cells such as ova and spermatozoa.)
A cell has DNAs and so on in a nucleus. DNAs, nucleuses, and so on are replicated during mitosis and identical cells are created through mitosis. The followings are simple explanations. Mitosis consists of some processes.

* "Animation of Mitosis" http://www.johnkyrk.com/mitosis.html
"Cell Cycle and Mitosis Tutorial Arizona" http://www.biology.arizona.edu/cell_bio/tutorials/cell_cycle/main.html
46 double-stranded helix DNAs in a cell are replicated into 96 double-stranded helix DNAs creating 2 identical double-stranded helix DNAs respectively during the S stage.
* DNA Replication in Wikipedia" http://en.wikipedia.org/wiki/DNA_replication
* "DNA Replication IB Biology" http://www.tokresource.org/tok_classes/biobiobio/biomenu/dna_replication/index.htm

The 2 identical double-stranded helix DNAs change into one X shape chromosome. 46 X shape chromosomes are created from 96 double-stranded helix DNAs. 46 X shape chromosomes are aligned along the middle of the cell nucleus. X shape chromosome is separated into 2 I shape chromosomes and they move to opposite sides of the cell respectively. The center of the cell is separated and 2 daughter cells are created. Each daughter cell has 46 I shape chromosomes identical to the parent cell.

Aside from that, it should be noted that Telomeres of DNAs are shortened during Mitosis cell division. A Telomere is a repetitive nucleotide unit such as TTAGGG at the end of DNA. A unit (TTAGGG) is lost through a Mitosis DNA replication (Mitosis cell division). The number of initial repetitions (repetitions in ova) is constant and when the cell divisions amounting to the repetition number are experienced, Telomeres are lost, normal cell division becomes impossible, and the living thing dies.

Telomere
*Attribution: http://en.wikipedia.org/wiki/File:Telomere.png

* "Telomere in Wikipedia" http://en.wikipedia.org/wiki/Telomere

2.1.12.2.6.8 Cell Division 2 (Meiosis)

2.1.12.2.6.8.1 Introduction

Meiosis is the special cell division, which creates reproductive cells such as ova and spermatozoa. It takes place at the ovaries or testes. Meiosis consists of 2 stages. Meiotic division 1 and Meiotic division 2.

2.1.12.2.6.8.2 Meiotic Division 1

In meiotic division 1, DNA replication and recombination take place. One double-stranded helix DNA is replicated to create 2 identical double-stranded helix DNAs. The original 46 double-stranded helix DNAs consist of 23 homologous pairs of double-stranded helix DNA, 23 from the mother and 23 from the father, aside from the 23rd double-stranded helix DNA of males. The original 46 double-stranded helix DNAs are replicated to create 92 double-stranded helix DNAs. Replicated 2 identical double-stranded helix DNAs form an X shape chromosome. 92 double-stranded helix DNAs change into 46 X shape chromosomes. Then 46 X shape chromosomes consist of 23 homologous X shape chromosome pairs (23 X shape chromosomes from the mother and 23 X shape chrimosomes from the father) aside from the 23rd X shape chromosomes of males. An X shape chromosome adheres to its homologous X shape chromosome and replacement (recombination) of partial DNA sequence (partial chromosome) between the 2 X shape chromosomes (one from the mother and the other from the father) starts. A certain length of chromosome from an edge of the chromosome (DNA) from the mother and the corresponding part of the chromosome (DNA) from the father are replaced (exchanged). It is called "chromosomal crossover."
* "Chromosomal Crossover in Wikipedia" https://en.wikipedia.org/wiki/Chromosomal_crossover
The site where the exchange occurs is called "chiasma." Thus chromosomes (DNAs) from the mother and from the father are partially exchanged and new double-stranded helix DNAs are created in ovaries and testes. Then DNAs are generally mixtures of double-stranded helix DNAs of maternal ancestors and paternal ancestors.
* "Meiosis IB Biology" http://www.tokresource.org/tok_classes/biobiobio/biomenu/meiosis/index.htm

Meiotic Procedure
*Attribution: http://en.wikipedia.org/wiki/File:Meiosis_diagram.jpg

Other than that, in contrast to Mitosis, the Telomeres wouldn't be shortened in reproductive cells (and in cancer cells) and during Meiotic cell division. Reproductive cells (and cancer cells) hold the specific enzyme Telomerase creating Telomere. When a Telomere is once lost through DNA replication in reproductive cells (or in cancer cells), Telomerase creates a Telomere and the length of Telomeres is recovered.
Then reproductive cells' Telomere length of children, parents, and ancestors are the same.

2.1.12.2.6.8.3 Meiotic Division 2

In meiotic division 2, first, X shape chromosomes of a homologous pair (partially recombinated) are separated and move to opposite sides of the cell. 23 X shape chromosomes move to a side and the other 23 X shape chromosomes move to the opposite side. The cell is divided into 2 cells. The divided new cells have 23 X shape chromosomes respectively. Then 23 X shape chromosomes in a new cell are separated into 46 I shape chromosomes. In this case, there are no identical DNAs or I shape chromosomes since partial recombination occurred. However, there are similar pairs. Then similar I shape chromosomes are separated to opposite sides of the cell. 23 I shape chromosomes are put on a side and the other 23 I shape chromosomes are put on the opposite side. Then the cell is divided into 2 cells again. Consequently, these final reproductive cells (ova and spermatozoa) have 23 I shape chromosomes (23 DNAs) respectively. The 23rd double-stranded helix DNA of ova is naturally X-DNA. On the other hand, the 23rd double-stranded helix DNA of spermatozoa is X-DNA or Y-DNA.

2.1.12.2.6.8.4 Fertilization

When an ovum encounters, fertilization occurs. They fuse, the fertilized egg has 46 double-stranded helix DNAs like ordinary human cells, and it starts ordinary cell division (mitosis) to grow.
The 23rd double-stranded helix DNA of an ova is X-DNA.
When the ova encountered a spermatozoon with X-DNA, the 23rd double-stranded helix DNAs (2 double-stranded helix DNAs) of the fertilized egg are "X-DNA" and "X-DNA," and the egg grows to be a woman. The combination of "X-DNA" and "X-DNA" directs to create ovaries, a womb, mammary glands, and breasts.
When the the ova encountered a spermatozoon with Y-DNA, the 23rd double-stranded helix DNAs (2 double-stranded helix DNAs) of the fertilized egg are "X-DNA" and "Y-DNA," and the egg grows to be a man. Y-DNA directs to interfere in creating ovaries, a womb, mammary glands, breasts, and it directs to create testes and other male reproductive organs.
Thus the 23rd double-stranded helix DNAs are sex-determining DNAs.

2.1.12.2.6.8.5 Exception of Crossover

Crossover occurs on most DNAs. However, Y-DNA and mitochondrial DNA are the exceptions.
The 23rd double-stranded helix DNAs of a cell of women are X-DNA and X-DNA. Crossover occurs between the 2 X-DNAs, one from the mother and the other from the father. X-DNAs are mixtures of maternal DNA and paternal DNA as well.
Yet since the 23rd double-stranded helix DNAs of a cell of men are X-DNA and Y-DNA, crossover doesn't occur in this case. Consequently, crossover doesn't occur exceptionally on Y-DNA (Y-chromosome) and Y-DNA (Y-chromosome) is copied from generation to generation without any change (aside from accidental copy errors or rare exceptions). Thus the sequences of Y-DNAs of males are basically inherited from the paternal ancestors. This is the significance of Y-DNA, which represents paternal ancestors.
Mitochondrial DNAs (mtDNAs) locate in mitochondria, outside of the nucleus, both in ova and spermatozoa. However, it is known that mitochondrial DNAs in spermatozoa are destroyed or excluded during fertilization. Then mitochondrial DNAs survive in ova are exclusively mothers'. Crossover doesn't occur and mitochondrial DNAs consequently represent maternal ancestors.
* "Mitochondrial DNA in Wikipedia" http://en.wikipedia.org/wiki/Mitochondrial_DNA






Return to the Home Page