Revealed Counsel 2.1.12

Disclaimer: This is Untrue.

2.1.12 Origin of the First Higher Organism and Various Species

2.1.12.1 Rael's Claims

According to Rael, Yahweh says that the theory of evolution is not entirely correct. The evolution of various forms could, in a sense, be described as sophistication of the creators' work. The large variety of living things—such as the colors of birds, their mating rituals, and the shape of antelope horns—could not have arisen by chance. They are the work of the artists.

2.1.12.2 Consideration for Evolution

2.1.12.2.1 General Considerations on the Emergence of Diverse Living Organisms

2.1.12.2.1.1 The Accidental Emergence of the First Higher Organism

The origin of life has long been a subject of debate. From a biochemical perspective, living organisms are so elaborate that they appear as though they were intentionally created. Thus, there are claims that reject the theory of Evolution, arguing that nearly all living organisms on Earth were created by a higher organism (also referred to as extraterrestrials).
However, even if one assumes that nearly all living organisms on Earth were created by a higher organism, the first higher organism to appear somewhere in the universe must have emerged by chance. (Here, the term "higher organism" refers to a being with the potential capability to manufacture devices that allow it to travel through the atmosphere at speeds exceeding the speed of sound for over an hour.)
Thus, while rejecting the chance-based evolution of various organisms, the claim that the first higher organism emerged by chance may appear contradictory. However, this seeming contradiction can be explained by the following reasoning:
"If the accidental emergence of the first higher organism had not occurred somewhere in the universe, no being capable of questioning this would exist." In other words, "The existence of a higher organism with the ability to contemplate (such as humans on Earth) is the result of the accidental emergence of a higher organism somewhere in the universe (including Earth)." (This is a line of reasoning similar to the anthropic principle in physics.)
* "Anthropic Principle on Wikipedia" https://en.wikipedia.org/wiki/Anthropic_principle
(On the other hand, even the theory of Evolution ultimately assumes that higher organisms (humans) emerged by chance. The theory holds that various other living organisms also appeared by chance before the emergence of higher organisms (humans).)

2.1.12.2.1.2 Overview of the First Higher Organism

The first higher organism is thought to have emerged by chance in an environment rich in carbohydrates, lipids, amino acids, proteins, and other essential compounds. While it is possible that the environment provided abundant nutrients, the higher organism may have also possessed photosynthetic capabilities, allowing it to function without relying on external nutrients.
Conversely, because it arose by chance, the first higher organism was likely a simple being without decorative functions. For instance, compared to asexual reproduction, sexual reproduction is far more complex and not necessarily essential for survival. Sexual reproduction requires the contact of male and female individuals, whereas asexual reproduction is significantly more efficient for species propagation.
If physical strength were necessary for survival, muscle enhancement through chemical agents such as 5-azacytidine would be far simpler than the random emergence of the complex mechanism of sexual reproduction. Sexual reproduction itself is a typical example of a decorative, elaborate function, with males being essentially a decorative new species.

It is conceivable that the first higher organism developed science and created other complex organisms with additional decorative functions, such as sexual reproduction. (There is also the possibility that the first higher organism did not possess a DNA-based mechanism and instead created the DNA system itself.)

2.1.12.2.1.3 "Emergence of the First Higher Organism" vs. "Emergence of Diverse Living Organisms"

The "emergence of the first higher organism" and the "emergence of diverse living organisms (including decorative functions)" must not be conflated. The emergence of the first higher organism was clearly accidental. The key question is whether "diverse living organisms (including decorative functions)" emerged by chance or were intentionally created.

Rael and Yahweh's view is that the "first higher organism" developed civilization and created diverse living organisms on other planets. If the first higher organism exists, the probability that it created diverse living organisms on other planets and fabricated fossils is estimated to be around 50%. It is merely a matter of whether they chose to carry out such a plan or not.

In contrast, the theory of Evolution posits that diverse living organisms emerged by chance before the emergence of the "first higher organism" (humans). However, the notion that all diverse living organisms (including decorative functions) appeared by chance is statistically highly improbable. (The miraculous emergence of the first higher organism leads to conceptual confusion, causing the theory of Evolution to retain an almost impossible probabilistic scenario of the random emergence of diverse living organisms.)

To accurately examine this theme, it is necessary to understand biological mechanisms and "selective gene expression" associated with "cell differentiation."

2.1.12.2.1.4 Cell Differentiation (Selective Gene Expression)

The growth of living organisms begins with a single egg cell (ovum). All cells are generated from this egg cell and possess the potential to differentiate into various cell types. For example: Cells located in the eyes develop into eye cells, cells near bones differentiate into bone cells, and cells in the liver become liver cells.
Cells differentiate into various tissue types according to their location. However, cells in the eyes do not transform into bone or liver cells. The eyes do not develop bones or a liver. This is known as "selective gene expression" and is believed to be controlled by specific signaling proteins and signaling molecules.
For instance, the molecule 5-azacytidine can transform 10T1/2 cells into myoblasts (precursor cells of muscle cells). In other words, 5-azacytidine converts immature cells into muscle cells.
* "Conversion of 10T1/2 to Myoblast in Cell 1986" http://www.cell.com/abstract/0092-8674(86)90507-6
* "Conversion of 10T1/2 to Myoblast in Cell 1986 from Science Direct" http://www.sciencedirect.com/science/article/pii/0092867486905076
* "Myoblast on Wikipedia" http://en.wikipedia.org/wiki/Myoblast

This is an example of a phenomenon known as cellular conversion. As demonstrated above, chemical substances can sometimes trigger cellular transformation. However, during the natural growth process, cell differentiation is primarily controlled by DNA. For example: A pigeon egg develops into a pigeon, a turtle egg develops into a turtle, and they do not develop into muscular monstrosities.
5-azacytidine is produced as a signaling molecule at specific sites (e.g., near the legs) under DNA instructions, leading to the formation of muscle cells at the appropriate location. DNA directs muscle cell formation along the legs but not in the brain.

2.1.12.2.1.5 DNA Mutations

The transformation of cells and changes in appearance are directed by instructions from DNA. However, if the cells on the back or arms of an organism that originally lacked wings were to transform into wing cells, the organism would become a bird or another flying creature. This is referred to as a "DNA base sequence mutation" (DNA mutation). In this case, a new species would emerge, contributing to the diversity of organisms.

However, if liver or brain cells transformed into wing cells, the organism would have difficulty surviving. If DNA mutations were not pre-programmed, they would occur randomly. This resembles radiation-induced mutations in radiation breeding. Organisms exposed to high radiation doses generally suffer from radiation damage, growth defects, or death. However, in extremely rare cases, DNA mutations may produce meaningful changes.

Even without deliberate intervention, a certain degree of natural DNA mutations occurs, leading to meaningful changes, which is considered evolution. The theory of Evolution posits that the accumulation of random DNA mutations is the primary driver of the emergence of diverse living organisms. However, meaningful changes are extremely rare, and behind them, many organisms suffer dysfunction or death.

An example of a meaningful yet non-essential change for survival would be the emergence of sexual reproduction. If sexual reproduction arose by chance, males would have to emerge by chance from females. (From an evolutionary perspective, egg-laying females are considered the fundamental form, while males are regarded as derivatives.)
Two coincidences would be required for sexual reproduction:
(1) The loss of asexual reproduction functionality.
(2) The emergence of a complementary new species (sperm-bearing males).
(The accidental emergence of sexual reproduction is highly improbable, which leans toward the hypothesis that humans, being sexually reproducing organisms, were created.)

2.1.12.2.1.6 The Accidental Emergence of Diverse Living Organisms (Including Decorative Functions)

As mentioned above, the accidental emergence of the "first higher organism" does not require proof. However, the prior accidental emergence of "diverse living organisms (including decorative functions)" is distinct. The theory of Evolution claims that, in addition to the accidental emergence of the first higher organism, numerous accidents produced diverse living organisms, implying that, for example, 1,000 species of living organisms would require 1,000 accidents.
The following explains the knowledge necessary to thoroughly examine whether various organisms were generated by chance or intentionally created.

DNA
*Attribution: http://en.wikipedia.org/wiki/File:ADN_animation.gif

2.1.12.2.2 Outline of Knowledge for Detailed Consideration

Doubt about evolution arises from knowledge of "Atoms (the non-existence of the soul)," "The Natural Law of Increasing Disorder," "Organic Chemistry," and "Biochemistry." To assess the credibility of evolution, it is particularly important to understand the fundamentals of organic chemistry and biochemistry, especially regarding DNA.

2.1.12.2.3 Atoms (Non-Existence of Soul)

First, some people believe in the existence of souls. Physicists have explored the origin of this world and what it is composed of. What they discovered as the building blocks of the world are atoms. Furthermore, atoms consist of protons, neutrons, and electrons (or more precisely, elementary particles). No physical elements associated with souls or spirits have been found. Living organisms are also made of atoms. They are comparable to SONY AIBO. AIBO appears as if it has will and a soul. However, AIBO is merely composed of atoms. Will, soul, and consciousness are simply phenomena that arise from atoms.

SONY AIBO following a Pink Ball
*Attribution: http://en.wikipedia.org/wiki/File:AIBO_ERS-7_following_pink_ball_held_by_child.jpg
* "AIBO on Wikipedia" https://en.wikipedia.org/wiki/AIBO

2.1.12.2.4 Natural Law of Disorder Increases

If there is no intervention by living organisms, particularly humans, well-ordered and useful physical entities will naturally become disordered and transform into useless, chaotic states. For example, mechanical wristwatches are well-ordered physical devices designed to show accurate time. However, without the intervention of living organisms (humans), they gradually become inaccurate over time. Physical entities naturally degrade into useless, disordered states. They never autonomously improve themselves in a useful way. The disorder (degree of uselessness) of physical entities naturally increases (except in the case of living organisms). This is an obvious natural law that can be observed everywhere.
*"Entropy on Wikipedia" http://en.wikipedia.org/wiki/Entropy

2.1.12.2.5 An Outline of Organic Chemistry to be Learned

2.1.12.2.5.1 Introduction to Organic Chemistry

The essential concepts of organic chemistry needed to understand doubts about evolution include "atoms," "alcohols," "carboxylic acids," "amines," and "amino acids."

2.1.12.2.5.2 Hydrocarbons and Alcohols

Hydrocarbons are a typical basic form of organic compounds. (Organic compounds are chemical substances primarily composed of carbon.)
For example, "Propane," which consists of 3 carbons and 8 hydrogens, is one of the most basic hydrocarbons.

A more advanced form of organic compounds includes oxygen-containing organic compounds.
When an "H" in propane is replaced with an "OH," it becomes propyl alcohol. Propyl alcohol is an example of an oxygen-containing organic compound.

2.1.12.2.5.3 Carboxylic Acids

Carboxylic acids are typical acids derived from alcohols, generally represented by the formula R-COOH. ("R" in the formula denotes an alkyl group or similar substituent.)
* "Structure of a Carboxylic acid from Wikipedia" http://en.wikipedia.org/wiki/File:Carboxylic-acid.svg
*"Carboxylic acid on Wikipedia" http://en.wikipedia.org/wiki/Carboxylic_acid
Propionic acid is an example of a carboxylic acid.

2.1.12.2.5.4 Amines

When one carbon in a hydrocarbon is replaced by one nitrogen, the resulting compound is an "amine," typically represented by the formula R-NH₂.
* "Structure of a typical Amine from Wikipedia" http://en.wikipedia.org/wiki/File:Ethylamine-2D-flat.png
*"Amine on Wikipedia" http://en.wikipedia.org/wiki/Amine
Ethylamine is an example of an amine. (Oxygen is not an essential element in this context.)

2.1.12.2.5.5 Amino Acids

Amino acids in living organisms are organic compounds that include (at least) both a carboxylic acid group and an amine group.
*"Amino acid on Wikipedia" http://en.wikipedia.org/wiki/Amino_acid
Glycine is the simplest example of an amino acid.

2.1.12.2.6 An Outline of Biochemistry to be Learned

2.1.12.2.6.1 Introduction to Biochemistry

To understand the doubtfulness of evolution, the following concepts in biochemistry should at least be learned: "proteins," "enzymes," "cells," "various cell substances," "cell nuclei," "DNAs," "RNAs," "protein biosynthesis by DNA and RNA," and the "cell cycle," including "cell division."
* "Biology Project Arizona" http://www.biology.arizona.edu/DEFAULT.html
Basic concepts of cells are explained on the following website.
* "Cell Tutorial Arizona" http://www.biology.arizona.edu/cell_bio/tutorials/cells/cells.html
There are two types of cells: prokaryotic cells and eukaryotic cells.
Prokaryotic cells are simple and characteristic of primitive bacteria, which digress from the main subject.
Eukaryotic cells are common in most other living organisms, including humans. The following descriptions primarily focus on eukaryotic cells.

2.1.12.2.6.2 Protein

A protein consists of many amino acids. Amino acids are linked together to form a chain. When the chain is short, it is called a "peptide." When the chain is long, it is called a "protein."
The structure of proteins is explained on the following Chemguide website.

An Example of Peptides
*Attribution: https://en.wikipedia.org/wiki/File:Tetrapeptide_structural_formulae_v.1.png
★ "Chemguide Protein Structure" http://www.chemguide.co.uk/organicprops/aminoacids/proteinstruct.html
*"Protein on Wikipedia" http://en.wikipedia.org/wiki/Protein
There is a wide variety of proteins.

2.1.12.2.6.3 Enzyme

Some proteins (including a vast variety) have specific functions to synthesize organic compounds that make up various cellular substances. These proteins are called "Enzymes." (It is said that the human body contains around 5,000 types of enzymes, while the total number of enzymes on Earth is estimated to exceed 25,000.) For example, one enzyme called aspartate-ammonia ligase (also known as asparagine synthetase) creates asparagine (a type of amino acid) from aspartate (the salt of aspartic acid, another type of amino acid) and ammonia. (The suffix "-ase" is generally used for enzymes.)
Reaction: ATP + L-aspartate + NH₃ → AMP + diphosphate + L-asparagine
(This reaction requires an energy supply. ATP (adenosine triphosphate) provides energy by converting into AMP (adenosine monophosphate).)
Thus, all of the various cellular substances are produced through diverse enzyme reactions.
★ "Chemguide Proteins as Enzymes" http://www.chemguide.co.uk/organicprops/aminoacids/enzymes.html#top

An Enzyme binding 2 molecules
*Attribution: https://en.wikipedia.org/wiki/File:Hexokinase_induced_fit.svg

2.1.12.2.6.4 Protein Biosynthesis

2.1.12.2.6.4.1 Outline

Enzymes (and proteins) are produced through protein biosynthesis in the cell. Protein biosynthesis consists of 2 processes. The first process is "transcription" in the cell nucleus. The second process is "translation" outside the nucleus. The components involved in protein biosynthesis are illustrated in the following image.

*Attribution https://commons.wikimedia.org/wiki/File:MRNA-interaction.png

Transcription is the process of creating messenger RNA (mRNA) by copying "base sequences" or "codons" from DNA. The components involved in transcription are DNA, RNA nucleotides, and RNA polymerase, which together form mRNA. The nucleus, enclosed by a nuclear envelope, is typically located in a eukaryotic cell. The nucleus contains most of the genetic material, including nucleoplasm (liquid), DNA, RNA (including transfer RNA), nucleoproteins, various enzymes, and the nucleolus (a structure responsible for ribosome production). Nucleoproteins form complexes with DNA and RNA, such as chromatin. The nuclear envelope contains selective nuclear pores that allow the controlled movement of specific molecules. On the other hand, ribosomes are located outside the nucleus.
Translation is the process of synthesizing proteins by connecting amino acids, which are collected and arranged by transfer RNA (tRNA) according to the codons on the mRNA.

2.1.12.2.6.4.2 Structure and Composition of Cells

Prior to explaining the details of protein biosynthesis, the basic structure of cells should be understood. The structure of a cell, including the nucleus, is illustrated in the image below.

The size (length) of human cells is about 10 µm on average. Oocytes (ova) are generally large, with a size of about 100 µm.
The outer wall of the cell is the cell membrane, which encloses various essential substances. The inside of the cell membrane is mostly filled with an aqueous liquid called "intracellular fluid" or "cytosol." The space outside the cells, between the cells, is filled with extracellular fluid.
* "Cytosol on Wikipedia" http://en.wikipedia.org/wiki/Cytosol
* "Extracellular Fluid on Wikipedia" https://en.wikipedia.org/wiki/Extracellular_fluid

The most essential component is the "nucleus."
The outer wall of the nucleus is called the nuclear envelope, which encloses DNA and other genetic material. DNA is sometimes arranged in the form of chromosomes. Other essential components include ribosomes, which are attached to the endoplasmic reticulum (ER), and mitochondria.
The interior of the cell is supported by a network of fibrous structures, including (a) microtubules, (b) microfilaments (such as actin filaments), and (c) intermediate filaments. The ends of these fibrous structures attach to the cell membrane or other components such as the nucleus. These fibers support the cell's shape, stabilize the position of organelles such as the nucleus, and enable shape changes in the cell. This network of fibrous structures is called the cytoskeleton.
The space outside the cells, between the cells, is supported by the extracellular matrix (ECM), which contains proteins such as integrins. The extracellular matrix sometimes adheres to cell membranes, helping to anchor and support the cells.
* "Cytoskeleton on Wikipedia" https://en.wikipedia.org/wiki/Cytoskeleton
* "Extracellular Matrix on Wikipedia" https://en.wikipedia.org/wiki/Extracellular_matrix
* "Integrin on Wikipedia" https://en.wikipedia.org/wiki/Integrin

All cellular components primarily consist of water, proteins, lipids, carbohydrates, and other similar substances. Most of these components are produced through enzyme-catalyzed reactions. Since enzymes are a type of protein, they are synthesized through protein biosynthesis.

Animal Cell Structure
Organelles are labelled as follows:
1. Nucleolus 2. Nucleus 3. Ribosome (the dots) 4. Vesicle 5. Rough endoplasmic reticulum 6. Golgi apparatus (or "Golgi body") 7. Cytoskeleton 8. Smooth endoplasmic reticulum 9. Mitochondrion 10. Vacuole 11. Cytosol 12. Lysosome 13. Centriole 14. Cell membrane
*Attribution: http://en.wikipedia.org/wiki/File:Animal_Cell.svg

* "Cell (Biology) on Wikipedia" https://en.wikipedia.org/wiki/Cell_(biology)

2.1.12.2.6.4.3 DNA

A single DNA strand is a long chain with short side branches. Two DNA strands form a twisted, ladder-like structure known as a double helix. The two strands are polynucleotide chains, and they are connected by base pairs, which act as the rungs of the ladder.

DNA Structure
*Attribution: http://en.wikipedia.org/wiki/File:DNA_Structure%2BKey%2BLabelled.pn_NoBB.png

The ladder-like structure of the two DNA strands can be simplified as follows.

In this case, "sugar" refers to deoxyribose. Deoxyribose is a modified form of ribose.
Ribose is a simple sugar containing five carbon atoms, with a molecular mass of 150. (For reference, the molecular mass of sucrose—the common sugar used in kitchens—is 342. Ribose has about half the molecular mass of sucrose.)
The solid lines in the illustration above represent covalent bonds, while the dotted lines represent ionic bonds.
In this case, "base" refers to a chemical base, the opposite of an acid. The specific bases in DNA are adenine (A), thymine (T), guanine (G), and cytosine (C). These are cyclic nitrogenous compounds. Adenine pairs with thymine, while guanine pairs with cytosine. The "Base - - - - Base" notation in the illustration represents an ionic bond between base pairs:
Adenine - - - - Thymine (A-T), Thymine - - - - Adenine (T-A), Guanine - - - - Cytosine (G-C), or Cytosine - - - - Guanine (C-G).
In this case, "phosphate ester" serves primarily as a connector.

* "DNA Structure Chemguide" http://www.chemguide.co.uk/organicprops/aminoacids/dna1.html

2.1.12.2.6.4.4 Nucleoside

A compound consisting of one "sugar" and one "base," bound together as shown below, is called a "nucleoside."

2.1.12.2.6.4.5 Nucleotide

A compound with an added phosphoric acid, as shown below, is called a "nucleotide." Nucleotides are the fundamental units of genetic material. The sugar component can be either deoxyribose or ribose, and in both cases, the compound is referred to as a "nucleotide."
When the sugar is deoxyribose, the nucleotide is a part of DNA, and the “base” is either A (adenine), T (thymine), G (guanine), or C (cytosine). When the sugar is ribose, the nucleotide is called an RNA nucleotide, and the "base" is either A (adenine), U (uracil), G (guanine), or C (cytosine). Uracil is an analog of thymine and is used in RNA instead of thymine, unlike in DNA. This is an exception to the general structural similarity between DNA and RNA, such as the difference between deoxyribose and ribose. Additionally, unlike DNA, RNA usually does not form double-stranded structures.
Both deoxyribose and ribose contain five carbon atoms, which are numbered. In a nucleotide, a phosphate group is attached to the 5th carbon of the sugar. Another phosphate group of a different nucleotide binds to the 3rd carbon, forming a nucleotide chain. This results in two directional ends, known as the 5' end and the 3' end. The orientation of these ends can be depicted as upward, downward, leftward, or rightward, depending on the context.

2.1.12.2.6.4.6 RNA

When the sugar is "ribose" (not deoxygenated) and a strand is formed as shown below, the strand is called "RNA (Ribonucleic Acid)." In other words, "RNA" is a chain of "RNA nucleotides." When "RNA nucleotides" are linked together, they form "RNA."

There are 3 major types of RNA: (1) Messenger RNA (mRNA) – a single-stranded RNA that carries genetic information, (2) Ribosomal RNA (rRNA) – a component of ribosomes, essential for protein synthesis, (3) Transfer RNA (tRNA) – helps decode messenger RNA sequences into proteins.

2.1.12.2.6.4.7 Transcription

2.1.12.2.6.4.7.1 Introduction

The first step in protein synthesis is transcription, which occurs in the cell nucleus and generates messenger RNA (mRNA). Transcription consists of 2 main steps:
(A) The first step is the synthesis of heterogeneous nuclear RNA (hnRNA), where "base sequences" or "three-base sequences" are copied from DNA.
(B) The second step, known as post-transcriptional processing, involves modifying hnRNA into messenger RNA (mRNA).

(A) The key components involved in the first step of transcription (hnRNA synthesis) include DNA, RNA nucleotides, RNA polymerase II, and other proteins called transcription factors, all of which function within the nucleus (inside the nuclear envelope). These elements work together to form heterogeneous nuclear RNA (hnRNA) by linking RNA nucleotides.
(There are three types of RNA polymerases: (i) RNA polymerase I synthesizes ribosomal RNA (rRNA), (ii) RNA polymerase II synthesizes messenger RNA (mRNA) (or more precisely, hnRNA before processing), and (iii) RNA polymerase III synthesizes transfer RNA (tRNA) and other small RNAs.)

A double-stranded DNA helix consists of 2 strands.
One of these is called the coding strand (sense strand) because its three-base sequences (codons) encode amino acids for protein synthesis. For example: AAC codes for asparagine, GAC codes for aspartic acid, and ATG codes for methionine. Each three-base sequence that specifies a particular amino acid is known as a codon. (More precisely, a "codon" refers to a three-base sequence on RNA, as described in the RNA codon table below.) Certain specific sequences play regulatory roles. For instance, the sequence ACATTTG marks the transcription initiation site of human β-globin (a protein in hemoglobin).
The other strand of DNA is called the template strand (antisense strand or noncoding strand) because its base sequences are merely complementary to those of the coding strand. Unlike the coding strand, the template strand does not directly encode amino acids. However, it serves as a template during transcription, allowing the formation of an mRNA sequence that matches the coding strand.
For example:
If the coding strand has the sequence AAC, the template strand will have the complementary sequence TTG.
During transcription, the resulting mRNA sequence will be AAC, identical to the coding strand (except that thymine (T) in DNA is replaced by uracil (U) in RNA).

(A) The first step of transcription, which generates heterogeneous nuclear RNA (hnRNA), consists of three stages: initiation, elongation, and termination.

(B) The second step of transcription, known as post-transcriptional processing, converts hnRNA into messenger RNA (mRNA) and consists of three stages: 5' cap addition, 3' polyadenylation, and splicing.

2.1.12.2.6.4.7.2 Initiation of Transcription

The initiation stage begins with the identification of the promoter region on the coding strand, followed by the binding of various proteins (enzymes), including RNA polymerase II.
The double-stranded DNA helix is extremely thin at the molecular level, as illustrated in its structural representations. In contrast, RNA polymerase II and other associated proteins are composed of hundreds or even thousands of amino acids. These proteins bind next to the double-stranded DNA helix.
Core promoters are particularly essential base sequences within promoter regions. The TATA box and CAAT box are typical examples of core promoters. The transcription start site (TSS), where transcription begins, is usually located several dozen base pairs downstream (toward the 3' end) from a core promoter on the coding strand.
A "TATA box" is a specific core promoter sequence (TATAAAA in the 5' to 3' direction) commonly found on the coding strand. A protein called Transcription Factor IID (TFIID) recognizes and binds to the TATA box, with the assistance of TFIIA. TFIID then facilitates the binding of TFIIB near the core promoter. TFIIF helps recruit RNA polymerase II, which binds downstream (toward the 3' end of the coding strand) adjacent to the core promoter, positioning it close to the TSS. Additionally, TFIIE, TFIIH, and TFIIJ associate with RNA polymerase II.
* "Chemguide Transcription from DNA to RNA" http://www.chemguide.co.uk/organicprops/aminoacids/dna3.html

If the promoter is a TATA box, the transcription start site (TSS) is located 20-25 base pairs downstream (toward the 3' end of the coding strand) from the TATA box. TFIIH initiates the partial and temporary unwinding of the double-stranded DNA helix at the promoter site, separating it into two strands: the coding strand and the template strand. RNA polymerase II then moves along the DNA, continuously unwinding a short segment of about 10 nucleotides at a time. The recognition protein within RNA polymerase II functions as if it "reads" the DNA sequences, despite being a mere chemical structure with no intelligence.

A concrete example of the human β-globin gene (which encodes a red blood cell protein) is shown below.
The blue "CATAAAA" is a variant of the TATA box, serving as a core promoter. The green "ACATT" marks the transcription start site (TSS). Sequences beyond the TSS are transcribed into heterogeneous nuclear RNA (hnRNA). The red "ATG" indicates the start codon, signaling the beginning of protein synthesis. The subsequent orange sequence ("GTG, CAC, CTG, ......, GGC, AGG") consists of meaningful codons that specify the first 30 amino acids of the synthesized protein. (AGG represents the 30th amino acid.) Such meaningful sequences of codons are called exons. As a result, the region between the green TSS and the red ATG is transcribed but not translated into amino acids. This region is known as the 5' untranslated region (5' UTR). The black sequence ("TTGGTA …… TTAGG") is non-coding. Such non-coding sequences embedded within coding regions are called introns (or intervening sequences). The next orange sequence ("CTG, CTG, GTG, ......, AGG") represents another exon, encoding the 31st to 104th amino acids of the protein. The first CTG corresponds to the 31st amino acid. The next orange sequence ("CTC, CTG, ...") represents the third exon, encoding amino acids 105 to 146. The final red "TAA" functions as a stop codon, signaling the end of amino acid translation. The green sequence ("GCTC...") is not translated into amino acids and is known as the 3' untranslated region (3' UTR). The blue sequence ("AATAAA") is the polyadenylation signal site, where the 3' poly(A) tail is added. The subsequent green sequence ending in "....CATTGC" is also part of the 3' UTR. The final black sequence ("AATGAT…….") is a non-coding intron.

CCCTGTGGAGCCACACCCTAGGGTTGGCCA ATCTACTCCCAGGAGCAGGGAGGGCAGGAG CCAGGGCTGGGCATAAAAGTCAGGGCAGAG CCATCTATTGCTTACATTTGCTTCTGACAC AACTGTGTTCACTAGCAACCTCAAACAGAC ACCATGGTGCACCTGACTCCTGAGGAGAAG TCTGCCGTTACTGCCCTGTGGGGCAAGGTG AACGTGGATGAAGTTGGTGGTGAGGCCCTG GGCAGGTTGGTATCAAGGTTACAAGACAGG TTTAAGGAGACCAATAGAAACTGGGCATGT GGAGACAGAGAAGACTCTTGGGTTTCTGAT AGGCACTGACTCTCTCTGCCTATTGGTCTA TTTTCCCACCCTTAGGCTGCTGGTGGTCTA CCCTTGGACCCAGAGGTTCTTTGAGTCCTT TGGGGATCTGTCCACTCCTGATGCTGTTAT GGGCAACCCTAAGGTGAAGGCTCATGGCAA GAAAGTGCTCGGTGCCTTTAGTGATGGCCT GGCTCACCTGGACAACCTCAAGGGCACCTT TGCCACACTGAGTGAGCTGCACTGTGACAA GCTGCACGTGGATCCTGAGAACTTCAGGGT GAGTCTATGGGACCCTTGATGTTTTCTTTC CCCTTCTTTTCTATGGTTAAGTTCATGTCA TAGGAAGGGGAGAAGTAACAGGGTACAGTT TAGAATGGGAAACAGACGAATGATTGCATC AGTGTGGAAGTCTCAGGATCGTTTTAGTTT CTTTTATTTGCTGTTCATAACAATTGTTTT CTTTTGTTTAATTCTTGCTTTCTTTTTTTT TCTTCTCCGCAATTTTTACTATTATACTTA ATGCCTTAACATTGTGTATAACAAAAGGAA ATATCTCTGAGATACATTAAGTAACTTAAA AAAAAACTTTACACAGTCTGCCTAGTACAT TACTATTTGGAATATATGTGTGCTTATTTG CATATTCATAATCTCCCTACTTTATTTTCT TTTATTTTTAATTGATACATAATCATTATA CATATTTATGGGTTAAAGTGTAATGTTTTA ATATGTGTACACATATTGACCAAATCAGGG TAATTTTGCATTTGTAATTTTAAAAAATGC TTTCTTCTTTTAATATACTTTTTTGTTTATC TTATTTCTAATACTTTCCCTAATCTCTTTC TTTCAGGGCAATAATGATACAATGTATCAT GCCTCTTTGCACCATTCTAAAGAATAACAG TGATAATTTCTGGGTTAAGGCAATAGCAAT ATTTCTGCATATAAATATTTCTGCATATAAA TTGTAACTGATGTAAGAGGTTTCATATTGC TAATAGCAGCTACAATCCAGCTACCATTCT GCTTTTATTTTATGGTTGGGATAAGGCTGG ATTATTCTGAGTCCAAGCTAGGCCCTTTTG CTAATCATGTTCATACCTCTTATCTTCCTC CCACAGCTCCTGGGCAACGTGCTGGTCTGT GTGCTGGCCCATCACTTTGGCAAAGAATTC ACCCCACCAGTGCAGGCTGCCTATCAGAAA GTGGTGGCTGGTGTGGCTAATGCCCTGGCC CACAAGTATCACTAAGCTCGCTTTCTTGCT GTCCAATTTCTATTAAAGGTTCCTTTGTTC CCTAAGTCCAACTACTAAACTGGGGGATATT ATGAAGGGCCTTGAGCATCTGGATTCTGCC TAATAAAAAACATTTATTTTCATTGCAATG ATGTATTTAAATTATTTCTGAATATTTTAC TAAAAAGGGAATGTGGGAGGTCAGTGCATT TAAAACATAAAGAAATGAAGAGCTAGTTCA AACCTTGGGAAAATACACTATATCTTAAAC TCCATGAAAGAAGGTGAGGCTGCAAACAGCT AATGCACATTGGCAACAGCCCTGATGCCTA TGCCTTATTCATCCCTCAGAAAAGGATTCA AGTAGAGGCTTGATTTGGAGGTTAAAGTTT TGCTATGCTGTATTTTACATTACTTATTGT TTTAGCTGTCCTCATGAATGTCTTTTCACT ACCCATTTGCTTATCCTGCATCTCTCAGCC TTGACTCCACTCAGTTCTCTTGCTTAGAGA TACCACCTTTCCCCTGAAGTGTTCCTTCCA TGTTTTACGGCGAGATGGTTTCTCCTCGCC TGGCCACTCAGCCTTAGTTGTCTCTGTTGT CTTATAGAGGTCTA……

RNA polymerase II (RNAP), accompanied by TFIIE, TFIIH, and TFIIJ, moves along the double-stranded DNA helix, displacing hydrogen bonds. Meanwhile, TFIID, TFIIA, and TFIIB remain at the core promoter. This separation is called "promoter clearance."
Once RNA polymerase II reaches the transcription start site (TSS), it begins to recruit and position complementary RNA nucleotides corresponding to the recognized bases on the template strand. As a result, an RNA chain is synthesized along the template strand. If the recognized base on the template strand is G (with C as its complementary base on the coding strand), RNA polymerase II incorporates a C-RNA nucleotide opposite to the G. If the recognized base on the template strand is A (with T as its complementary base on the coding strand), RNA polymerase II incorporates a U-RNA nucleotide opposite to the A.
The unwound region of the double-stranded DNA helix remains limited in length. As RNA polymerase II moves forward, the previously separated strands behind it reanneal, restoring the original double-stranded helical structure.

* https://en.wikipedia.org/wiki/File:Simple_transcription_elongation1.svg

2.1.12.2.6.4.7.3 Elongation of Transcription

Elongation is the stage where RNA polymerase II recruits, incorporates, and links RNA nucleotides, thereby extending the RNA chain and synthesizing the hnRNA strand.

2.1.12.2.6.4.7.4 Termination of Transcription

When termination sequences are recognized, transcription stops, completing the hnRNA strand. The hnRNA is a copy of the coding strand from the TSS to the terminal region, except that thymine (T) in DNA is replaced by uracil (U) in RNA.
Referring to the above example, the hnRNA sequence begins with "ACATTTG…" and ends with "…CATTGC."

2.1.12.2.6.4.7.5 Capping and Poly(A) Addition

Once hnRNA is synthesized, it must be protected from enzymatic degradation through 5' capping and 3' polyadenylation.
5' Capping is the process of adding a "cap structure" to the 5' end of hnRNA to protect it.
3' Polyadenylation is the process of adding a "poly(A) tail" to the 3' end of hnRNA for protection. In the example above, the poly(A) tail is added at the AATAAA sequence.
* "5' cap on Wikipedia" http://en.wikipedia.org/wiki/5'_cap
* "Polyadenylation on Wikipedia" http://en.wikipedia.org/wiki/Polyadenylation

2.1.12.2.6.4.7.6 RNA Splicing

Splicing is the process of removing introns from hnRNA. After splicing, the hnRNA is processed into a mature messenger RNA (mRNA) strand.
* "RNA Splicing on Wikipedia" http://en.wikipedia.org/wiki/RNA_splicing

2.1.12.2.6.4.8 Translation

2.1.12.2.6.4.8.1 Introduction

Translation is the process of protein synthesis at ribosomes, which are located outside the cell nucleus.
* "Chemguide Protein Synthesis from mRNA to a Protein Chain" http://www.chemguide.co.uk/organicprops/aminoacids/dna5.html
The key components of translation are messenger RNA (mRNA), transfer RNA (tRNA), and ribosomes.
Messenger RNA is transcribed in the nucleus and then transported through nuclear pores to the cytoplasm.
Ribosomes are complexes of proteins and ribosomal RNA (rRNA). Each ribosome consists of two subunits. Like mRNA, rRNA is synthesized by RNA polymerases.
* "Ribosome on Wikipedia" http://en.wikipedia.org/wiki/Ribosome
* "Role of Ribosome" http://www.cytochemistry.net/cell-biology/ribosome.htm
Transfer RNA (tRNA) molecules are mostly composed of RNA strands and are also synthesized by RNA polymerases, like mRNA. They adopt a cloverleaf secondary structure and contain a specific three-base sequence called an "anticodon." Each anticodon is designed to complement a specific codon on mRNA. For example, a tRNA with the anticodon "GCA" binds to the codon "CGU" on mRNA. Additionally, each tRNA carries a specific amino acid at its 3' end, following the RNA codon table.
For instance, when the anticodon of a tRNA is "CUU," the corresponding mRNA codon is "GAA," and glutamic acid is attached to the tRNA according to the RNA codon table.
* "Transfer RNA on Wikipedia" http://en.wikipedia.org/wiki/Transfer_RNA
* "RNA Codon Table on Wikipedia" http://en.wikipedia.org/wiki/Genetic_code#RNA_codon_table

2.1.12.2.6.4.8.2 Initiation of Translation

First, the small subunit of a ribosome binds to a messenger RNA (mRNA). An initiator transfer RNA (tRNA), which has the UAC anticodon and carries methionine, recognizes the complementary AUG codon on the mRNA and binds to it. (Methionine is a type of amino acid.) (As mentioned earlier, ATG is the first three-base sequence translated during protein synthesis from the human β-globin gene in DNA. This means that AUG is the first codon on RNA to be translated, acting as the start signal for translation.) Then, the large subunit of the ribosome binds to the small subunit, enclosing the mRNA. Ribosomes have 2 binding sites for tRNAs: (1) A site (Aminoacyl site) and (2) P site (Peptidyl site) The first tRNA carrying methionine occupies the P site, preparing for elongation.

2.1.12.2.6.4.8.3 Elongation of Translation

The mRNA moves forward by one codon (three bases) within the ribosome, along with the first tRNA still bound to the mRNA. The first tRNA shifts from the A site to the P site, leaving the A site vacant. A new tRNA, whose anticodon complements the next codon on the mRNA, binds to the A site. For example, if the second codon on the mRNA is CCG, then a tRNA with the GGC anticodon, carrying proline, binds to it. At this point, the methionine (from the first tRNA) and the proline (from the second tRNA) are joined together, forming a peptide bond. Next, the mRNA shifts forward by one more codon. The tRNA that was in the P site leaves, and the tRNA that was in the A site moves to the P site. This process repeats: (A) A new tRNA arrives at the A site. (B) Its amino acid is linked to the growing chain. (C) The mRNA shifts forward, and the tRNA in the P site exits. As the chain lengthens, it is initially called a peptide. When it grows longer, it becomes a protein.

Schematic of Peptide/Protein Synthesis
*Attribution: https://en.wikipedia.org/wiki/File:Peptide_syn.svg

2.1.12.2.6.4.8.4 Termination of Translation

As shown in the RNA codon table, the stop codons are UAA, UAG, and UGA. These codons signal the termination of translation.
* "Stop Codon on Wikipedia" http://en.wikipedia.org/wiki/Stop_codon
When a stop codon enters the ribosome, translation stops, and the newly synthesized protein is released. Some proteins, such as enzymes, play functional roles in synthesizing organic compounds, modifying cellular substances, or regulating cellular activity, transformation, and structural changes.

2.1.12.2.6.5 Transportation, Motion, and Transmission

Thus, proteins and enzymes are created. However, these proteins, enzymes, and other substances produced through enzymatic reactions must be transported to their proper locations within the cell (or outside the cell). Many substances move passively through diffusion. However, certain substances are actively transported by motor proteins along the cytoskeleton—fibrous structures within the cell—or by other mechanisms.

Motor proteins, such as kinesins, are responsible for intracellular transport.
Kinesins move along microtubules, binding to specific substances and transporting them within the cell. For example, a kinesin can bind to a mitochondrion and transport it along a microtubule.

Another example of a cellular transport mechanism involves the contraction and elongation of actin filaments.
Actin is a type of protein, and a single actin molecule has a molecular weight of approximately 42,000 Da. It has a globular (spherical) shape but can also be described as square cushion-shaped. When an actin molecule exists individually, it is called G-actin (globular actin).
Multiple G-actin molecules polymerize through the action of ATP (adenosine triphosphate) and other factors to form filaments. These filaments are called F-actin (filamentous actin) or actin filaments. F-actin can elongate by adding more G-actin molecules through ATP-driven polymerization. Conversely, it can shorten when parts of F-actin depolymerize into G-actin molecules.
Actin filaments can expand and contract within the cell, allowing portions of the cell membrane to protrude, forming lamellipodia (temporary projections), or retract. This dynamic restructuring enables cell movement.

Motor proteins bind to specific substances and transport them or alter the shape of the cell, facilitating cellular processes such as the cell cycle and cell division.

Schematic View of Cytoskeleton
*Attribution: https://commons.wikimedia.org/wiki/File:Cytoskeleton_Components.png

Image of the Cytoskeleton in the cells.
A blue circle correspods to a Nucleus in a cell. Actin filaments are shown in red. Microtubules are shown in green.
* "Cytoskeleton on Wikipedia" https://en.wikipedia.org/wiki/Cytoskeleton

Animation of a Kinesin Moving along a Microtubule
* "Motor Protein on Wikipedia" https://en.wikipedia.org/wiki/Motor_protein
* "Kinesin on Wikipedia" https://en.wikipedia.org/wiki/Kinesin

Diagram of Conversion from G-Actin to F-Actin
* "Actin on Wikipedia" https://en.wikipedia.org/wiki/Actin

A Cell Forming Lamellipodia
* "Lamellipodium on Wikipedia" https://en.wikipedia.org/wiki/Lamellipodium

The extracellular matrix sometimes plays a role in signal transmission between cells. Other molecules, such as signaling proteins or hormones, can also mediate intercellular communication.

2.1.12.2.6.6 DNA Structure, the Cell Cycle, and Diploidy

Before learning about cell division, it is essential to understand the structure of DNA.
Human cells contain 46 double-stranded helical DNA molecules in their nuclei—23 inherited from the mother and 23 from the father. This condition is referred to as diploidy. Each pair of corresponding DNA molecules, one from each parent, is called a homologous pair. The first DNA (chromosome) from the mother and the first DNA (chromosome) from the father are similar and form a homologous pair, as do the second DNA (chromosomes), and so on, except for the 23rd pair in males.
The 23rd pair of DNA (chromosomes) determines biological sex and is called the sex chromosomes. In females, both sex chromosomes are X-DNA (X chromosomes) (XX), forming a homologous pair. In males, however, the sex chromosomes consist of one X chromosome from the mother and one Y-DNA (Y chromosome) from the father (XY), which are not fully homologous but still function as a pair in a broader sense.
The first 22 pairs of chromosomes, which are not involved in sex determination, are called autosomes, while the 23rd pair is referred to as allosomes or sex chromosomes.

23 Pairs of Human Male Double-stranded Helical DNA in the Shape of Chromosome
*Attribution: http://en.wikipedia.org/wiki/File:NHGRI_human_male_karyotype.png

DNAs show some types in shape.

Shapes of DNA
from left to right
(1) DNA Double-Stranded Helix, (2) Nucleosome, (3) 10 nm "Beads-on-a-String" Chromatin Fibre,
(4) 30 nm Chromatin Fibre, (5) 30 nm Chromatin Fibre (wide view),
(6) Active Chromosome, (7) Active Chromosome (wide view),
(8) Metaphase Chromosome, (9) Metaphase Chromosome (wide view)
*Attribution: http://en.wikipedia.org/wiki/File:Chromatin_Structures.png

(1) A double-stranded helical DNA is essentially a twisted, elongated ladder-like structure.

(2) Nucleosome
Since the total length of human DNA in a single cell is approximately 2 meters, yet it must fit within a nucleus that is only about 10 μm in diameter, DNA is typically compacted (wound) around histone proteins.
Histones are a type of protein. 8 histone molecules form "a histone octamer." DNA wraps around these histone octamers, forming structures known as nucleosomes. Each nucleosome consists of DNA wound around "a histone octamer" approximately two times.

Nucleosome
*Attribution: http://en.wikipedia.org/wiki/File:Nucleosome_organization.png

* "Nucleosome on HubPages" http://nathanielzhu.hubpages.com/hub/Nucleosome-Structure-Part-1
* "Nucleosome on Wikipedia" http://en.wikipedia.org/wiki/Nucleosome

(3) Chromatin (10 nm Beads-on-a-String Chromatin Fibre)
A chain of nucleosomes forms chromatin. This compacts the length of double-stranded helical DNA into a more condensed structure. Initially, nucleosomes assemble into a 10 nm beads-on-a-string chromatin fiber.
The 10 nm beads-on-a-string chromatin fiber is transcriptionally active, likely because the DNA remains only partially wound around histones, leaving many regions exposed for transcription factors to access.

Beads-on-a-String
*Attribution: http://en.wikipedia.org/wiki/File:Chromatin_Structures.png

(4) Chromatin (30 nm Chromatin Fibre)
When the 10 nm beads-on-a-string chromatin fiber undergoes further compaction, it forms a 30 nm chromatin fiber.
The 30 nm chromatin fiber is less active in transcription (protein synthesis), likely because the double-stranded helical DNA is more tightly packed and less exposed.
Since nucleosomes partially bind to DNA, they can hinder transcription. This means that the organization of nucleosomes and chromatin plays a crucial role in regulating gene expression, protein biosynthesis, and ultimately determining cellular properties.

(6) Active Chromosome
With the addition of scaffold proteins, active chromosomes are formed.

(8) Metaphase Chromosome
Further addition of scaffold proteins results in the formation of metaphase chromosomes.
Metaphase is the stage just before cell division, and metaphase chromosomes are fully condensed and ready to be separated.

*Attribution: http://en.wikipedia.org/wiki/File:Metaphase.svg

The form of DNA or chromatin changes throughout the cell cycle (the life cycle of a cell). The cell cycle is explained in the following resource:
* "Cell Cycle on Wikipedia" https://en.wikipedia.org/wiki/Cell_cycle
The cell cycle includes mitosis (ordinary cell division), and the phases of mitosis are described in the following resource:
* "Mitosis on Wikipedia" https://en.wikipedia.org/wiki/Mitosis

G1 Phase (Growth1/ Gap1)
At the beginning of the G1 phase, just after mitosis (cell division), double-stranded helical DNA (chromatin) remains in a condensed form known as chromosomes, as a remnant of cell division.
A chromosome is a highly condensed form of double-stranded helical DNA or chromatin, appearing as a thick, short rod-like structure. At this stage, a chromosome does not take the familiar "X" shape, but rather an "I" shape (or slightly curved, resembling a "C"). DNA or chromatin is condensed into chromosomes because this compact form is more suitable for the previous cell division.
It is important to note that a chromosome is merely a temporary structural form of double-stranded helical DNA during cell division. (The term "chromosome" originates from the Greek word for "color," as chromosomes were easily stained and identified in early biochemical experiments.)
During the mid-G1 phase, the chromosome structure is decondensed, and double-stranded helical DNA returns to the chromatin state, forming the "beads-on-a-string" structure.

Mitotic Cell Cycle
*Attribution: http://en.wikipedia.org/wiki/File:Animal_cell_cycle.svg

S Phase (DNA Synthesis)
When the cell enters the S phase (the period of DNA synthesis), histone octamers temporarily dissociate from double-stranded helical DNA to allow DNA replication. However, the nucleosome structure (chromatin) is quickly restored on the replicated DNA. After DNA replication, the cell contains 46 × 2 = 92 double-stranded helical DNA molecules.

G2 Phase (Growth2/ Gap2)
Next, the cell enters another growth phase, preparing for mitosis.

M Phase (Mitotic Phase)
When the cell enters the M phase (the phase of cell division), the 92 DNA molecules (or chromatin structures) condense into chromosomes. At this stage, each pair of replicated double-stranded helical DNA molecules forms a single X-shaped chromosome. (Each X-shaped chromosome consists of two double-stranded helical DNA molecules.) Therefore, the cell has 46 X-shaped chromosomes.
During mitosis, these 46 X-shaped chromosomes are separated into 92 I-shaped chromosomes. Then, 46 I-shaped chromosomes move to each side of the cell, ensuring that each new cell receives the correct number of chromosomes.
As a result, at the beginning of the G1 phase, just after mitosis, a new cell contains 46 I-shaped chromosomes.
It is important to note that "X-shaped chromosomes" and "X-DNA" (the 23rd chromosome) are not the same. Additionally, when X-DNA (the 23rd double-stranded helical DNA molecule) condenses into a chromosome, it is called an "X chromosome." However, the "X chromosome" (the chromosomal form of the 23rd DNA molecule) and an "X-shaped chromosome" (a general term for any replicated chromosome) are distinct concepts.

2.1.12.2.6.7 Cell Division 1 (Mitosis)

2.1.12.2.6.7 Cell Division 1 (Mitosis) Cell division, which increases the number of cells, is essential for growth and the maintenance of body tissues, as cells gradually die due to their lifespan or injury. Cell division involves a series of enzymatic reactions, ultimately driven by protein biosynthesis, as mentioned earlier.
Cell division is the process by which a single cell divides into two or more cells, increasing the total number of cells. There are 2 types of cell division: "mitosis" and "meiosis." "Mitosis" is the ordinary cell division that produces two genetically identical daughter cells from a single parent cell. ("Meiosis" (explained later) is a special type of cell division that produces reproductive cells such as ova and spermatozoa.)
Since cells contain DNA and other essential components within their nucleus, mitosis ensures that DNA and cellular structures are accurately replicated and distributed, resulting in two identical daughter cells. The following is a simplified explanation of mitosis.

* "Animation of Mitosis" http://www.johnkyrk.com/mitosis.html
* "Cell Cycle and Mitosis Tutorial Arizona" http://www.biology.arizona.edu/cell_bio/tutorials/cell_cycle/main.html
During the S phase of the cell cycle, the 46 double-stranded helical DNA molecules in a cell are replicated, resulting in 92 double-stranded helical DNA molecules. Each pair of identical DNA molecules forms a single X-shaped chromosome, meaning that the cell contains 46 X-shaped chromosomes after replication.
* "DNA Replication on Wikipedia" http://en.wikipedia.org/wiki/DNA_replication
* "DNA Replication IB Biology" http://www.tokresource.org/tok_classes/biobiobio/biomenu/dna_replication/index.htm

The 2 identical double-stranded helical DNAs combine to form one X-shaped chromosome. 46 X-shaped chromosomes are created from 96 double-stranded helical DNAs. The 46 X-shaped chromosomes align along the center of the cell nucleus. Each X-shaped chromosome is separated into 2 I-shaped chromosomes, which move to opposite sides of the cell. The cell membrane divides, resulting in the creation of 2 daughter cells. Each daughter cell contains 46 I-shaped chromosomes, identical to those in the parent cell.
Additionally, it should be noted that telomeres of DNA are shortened during mitosis. A telomere is a repetitive nucleotide sequence, such as TTAGGG, at the end of a DNA strand. This sequence (TTAGGG) is progressively lost during DNA replication in mitosis. The initial number of repetitions (set at birth, particularly in ova) is constant. Once the cell undergoes enough divisions to exhaust its telomere repeats, telomeres are lost, normal cell division becomes impossible, and the organism dies.

Telomere
*Attribution: http://en.wikipedia.org/wiki/File:Telomere.png

* "Telomere on Wikipedia" http://en.wikipedia.org/wiki/Telomere

2.1.12.2.6.8 Cell Division 2 (Meiosis)

2.1.12.2.6.8.1 Introduction

Meiosis is a special type of cell division that creates reproductive cells, such as ova and spermatozoa. It occurs in the ovaries or testes. Meiosis consists of two stages: Meiotic Division I and Meiotic Division II.

2.1.12.2.6.8.2 Meiotic Division I

In Meiotic Division I, DNA replication and recombination occur. One double-stranded helical DNA molecule is replicated to create 2 identical double-stranded helical DNA molecules. The original 46 double-stranded helical DNA molecules consist of 23 homologous pairs, with 23 from the mother and 23 from the father, excluding the 23rd chromosome in males. The original 46 double-stranded helical DNA molecules are replicated to create 92 double-stranded helical DNA molecules. 2 identical double-stranded helical DNA molecules form one X-shaped chromosome. 92 double-stranded helical DNA molecules change into 46 X-shaped chromosomes. The 46 X-shaped chromosomes consist of 23 homologous pairs (23 X-shaped chromosomes from the mother and 23 from the father), excluding the 23rd chromosome in males.
An X-shaped chromosome pairs with its homologous X-shaped chromosome, and recombination (exchange) of DNA sequences between the two X-shaped chromosomes (one from the mother and one from the father) begins. A certain length of chromosome from one end of the chromosome (DNA) from the mother is exchanged with the corresponding part of the chromosome (DNA) from the father. This is called chromosomal crossover.
* "Chromosomal Crossover on Wikipedia" https://en.wikipedia.org/wiki/Chromosomal_crossover
The site where the exchange occurs is called a "chiasma." Thus, chromosomes (DNA) from the mother and father are partially exchanged, and new double-stranded helical DNA molecules are created in the ovaries and testes. The resulting DNA molecules are generally mixtures of maternal and paternal genetic material.
* "Meiosis IB Biology" http://www.tokresource.org/tok_classes/biobiobio/biomenu/meiosis/index.htm

Meiotic Procedure
*Attribution: http://en.wikipedia.org/wiki/File:Meiosis_diagram.jpg

Other than that, in contrast to mitosis, telomeres are not shortened in reproductive cells (or in cancer cells) during meiotic cell division. Reproductive cells (and cancer cells) contain the specific enzyme telomerase, which creates telomeres. When a telomere is lost during DNA replication in reproductive cells (or in cancer cells), telomerase creates a new telomere and the length of telomeres is restored.
Thus, the telomere length in the reproductive cells of children, parents, and ancestors is the same.

2.1.12.2.6.8.3 Meiotic Division II

In meiotic division II, the X-shaped chromosomes of a homologous pair (partially recombined) are separated and move to opposite sides of the cell. 23 X-shaped chromosomes move to one side, and the other 23 X-shaped chromosomes move to the opposite side. The cell divides into two cells. The newly divided cells each have 23 X-shaped chromosomes. Then the 23 X-shaped chromosomes in each new cell are separated into 46 I-shaped chromosomes. In this case, there are no identical DNA molecules or I-shaped chromosomes because partial recombination occurred. However, there are homologous pairs.
Then the homologous I-shaped chromosomes are separated to opposite sides of the cell. 23 I-shaped chromosomes are placed on one side, and the other 23 I-shaped chromosomes are placed on the opposite side. The cell divides into two cells again.
Consequently, these final reproductive cells (ova and spermatozoa) each have 23 I-shaped chromosomes (23 DNA molecules). The 23rd double-stranded helical DNA molecule of ova is naturally X-DNA. On the other hand, the 23rd double-stranded helical DNA molecule of spermatozoa is either X-DNA or Y-DNA.

2.1.12.2.6.8.4 Fertilization

When an ovum is encountered by a sperm, fertilization occurs. They fuse, and the fertilized egg has 46 double-stranded helical DNA molecules, like ordinary human cells, and begins ordinary cell division (mitosis) to grow. The 23rd double-stranded helical DNA molecule of an ovum is X-DNA.
When the ovum encounters a spermatozoon with X-DNA, the 23rd double-stranded helical DNA molecules (2 DNA molecules) of the fertilized egg are "X-DNA" and "X-DNA," and the egg develops into a female. The combination of "X-DNA" and "X-DNA" directs the development of ovaries, a womb, mammary glands, and breasts.
When the ovum encounters a spermatozoon with Y-DNA, the 23rd double-stranded helical DNA molecules (2 DNA molecules) of the fertilized egg are "X-DNA" and "Y-DNA," and the egg develops into a male. Y-DNA interferes with the development of ovaries, a womb, mammary glands, and breasts, and directs the development of testes and other male reproductive organs.
Thus, the 23rd double-stranded helical DNA molecules are sex-determining DNA.

2.1.12.2.6.8.5 Exception of Crossover

Crossover occurs in most DNA molecules. However, Y-DNA and mitochondrial DNA are exceptions.
The 23rd double-stranded helical DNA molecules in a female's cell are X-DNA and X-DNA. Crossover occurs between the two X-DNAs, one from the mother and one from the father. X-DNAs are mixtures of maternal and paternal DNA as well.
However, since the 23rd double-stranded helical DNA molecules in a male's cell are X-DNA and Y-DNA, crossover does not occur in this case. Consequently, crossover does not occur on Y-DNA (Y-chromosome), and Y-DNA (Y-chromosome) is passed from generation to generation without change, except for accidental copy errors or rare exceptions. Thus, the sequences of Y-DNA in males are primarily inherited from paternal ancestors. This is the significance of Y-DNA, which represents paternal ancestry.
Mitochondrial DNA (mtDNA) is located in mitochondria, outside the nucleus, in both ova and spermatozoa. However, it is known that mitochondrial DNA in spermatozoa is destroyed or excluded during fertilization. Thus, mitochondrial DNA that survives in the ovum is exclusively from the mother. Crossover does not occur, and mitochondrial DNA consequently represents maternal ancestry.
* "Mitochondrial DNA on Wikipedia" http://en.wikipedia.org/wiki/Mitochondrial_DNA

Return to the Home Page